To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 161 | Trypanosoma cruzi-Thrombospondin Parasite Receptor (T6) | Cells | Trypanosoma cruzi-Thrombospondin Parasite Receptor | 103 | 400 nM | 50 uM RNA containing 20 mM glucose | 49.51% | 5'-ACCGAGUCCAGAAGCUUGUAGUACUCAAUACUCAAGCAAGCCCAGCCCUACCAACCCCGGAGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC-3' | Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762. |
| 162 | Trypanosoma cruzi-Laminin Parasite Receptor (L28) | Cells | Trypanosoma cruz-Laminin Parasite Receptor | 107 | 209 nM | 50 uM RNA containing 20 mM glucose. | 46.73% | 5'-ACCGAGUCCAGAAGCUUGUAGUACUUAUGUCCCAUCGAACGCAGUGUAUCUUGCACCGACUCUCUGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC-3' | Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762. |
| 163 | Trypanosoma cruzi-Fibronectin Parasite Receptor (F4) | Cells | Trypanosoma cruzi-Fibronectin Parasite Receptor | 107 | 124 nM | 50 uM RNA containing 20 mM glucose. | 53.27% | 5'-ACCGAGUCCAGAAGCUUGUAGUACUGACCCUUCCCGACGCACGGACCAGUGAUGCCAACCCACCCGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC-3' | Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762. |
| 164 | Trypanosoma cruzi-Heparan Parasite Receptor (HS6) | Cells | Trypanosoma cruzi-Heparan Parasite Receptor | 107 | 40 nM | 50 uM RNA containing 20 mM glucose. | 52.34% | 5'-ACCGAGUCCAGAAGCUUGUAGUACUACCGCAACGUUGGCGUUCGGCGUUGGCCGCGUCAUCGCUAGCCUAGAUGGAGUUGAAUUCUCCCUAUAGUGAGUCGUAUUAC-3' | Ulrich et al. "In Vitro Selection of RNA Aptamers That Bind to Cell Adhesion Receptors of Trypanosoma cruzi and Inhibit Cell Invasion." The Journal of Biological Chemistry, 277 (2002): 20756-20762 |
| 165 | HIV-1 R5 Glycoprotein gp120 (B4) | Protein | HIV-1 R5 SU Glycoprotein | 114 | 5 nM | HBS Buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 2.7 mM KCl) | 47.37% | 5'-AAUUAACCCUCACUAAAGGGAACUGUUGUGAGUCUCAUGUCGAAGAGCGGUUAAGGGAGAUUUAGGCAGCAGCUUGGACAGUGUAUCGGCUGAGUUGAGCGUCUAGUCUUGUCU-3' | Khati, M., et al. "Neutralization of Infectivity of Diverse R5 Clinical Isolates of Human Immunodeficiency Virus Type 1 by gp120-Binding 2'F-RNA Aptamers." Journal of Virology, 77(2003): 12692-12698. |
| 166 | PrP Fibrils (SAF-93) | Protein | PrP Fibrils | 116 | 23.4 nM | Binding Buffer (20 mM Hepes (pH 7.2), 100 mM NaCl, 50 mM KCl, 10 mM MgCl2) | 49.14% | 5'-GGGAGACAAGACUAGACGCUCAACUACGAACUCAUGACACAAGGAUGCAAUCUCAUCCCGCCAGCCCACCGUUUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU-3' | Rhie, A., et al. "Characterization of 2'-fluoro-RNA aptamers that bind preferentially to disease-associated conformations of prion protein and inhibit conversion." Journal of Biological Chemistry, 278 (2003): 39697-705. |
| 167 | HIV-1 R5 SU Glycoprotein gp120 (B40) | Protein | HIV-1 R5 gp120 | 117 | 21 nM | cHBS buffer: 10 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM CaCl 2, 1 mM MgCl2, 2.7 mM KCl | 48.72% | 5'-GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUUACGCUUUUACCCGCACGCGAUUGGUUUGUUUUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU-3' | A. K. Dey et. al. Structural characterization of an anti-gp120 RNA aptamer that neutralizes R5 strains of HIV-1. RNA 11:873-884 |
| 168 | Osteopontin (2-O-Me OPN-R3) | Protein | Human Osteopontin | 40 | 18 nM | Binding Buffer: PBS (137 nM NaCl, 27 nM KCl, 100 nM Na2HPO4, 2 nM K2HPO4, pH 7.4) | 45.00% | 5'-CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG-3' | Z Mi et al. RNA aptamer blockade of osteopontin inhibits growth and metastasis of MDA-MB231 breast cancer cells. Molecular Therapy 17(2009): 153-161 |
| 169 | 2'-O-Methyl modified RNA aptamer | Protein | p53 | 75 | N/A nM | 0.15 mM Hepes [pH 7.4], 0.3 mM KCl, 6 uM dithiothreitol [DTT], 6 uM MgCl2, 1.1 uM ethylenediaminetetraacetic acid [EDTA], 6% glycerol, and 3 uM phenylmethanesulfonyl fluoride [PMSF] | 48.00% | 5'-GGGCGAAUUCGGGUUGGAUAGUAGGCGCAUAUGGCAUCUUCGUGGUUGUGUAUUGCCCUUUAGUGAGGGUUAAUU-3' | Shwetha, N. et al. "Aptamer??nanoparticle-based chemiluminescence for p53 protein." Analytical Biochemistry 2013, 441: 73-79. |
| 170 | Acetylcholine Receptor Antibody (mAB198) | Protein | Acetylcholine Receptor Antibody (mAB198) | 48 | 60 nM | Binding Buffer (30mM Tris-HCl (pH 7.5), 150 mM NaCl, 10mM MgCl2, 2mM dithiothreitol, 1% BSA) | 68.75% | 5'-UGGGCCGGAGGUUAGCUUGCCCAUGGCAAGCAGGGCGCCACGGACCCA-3' | Lee, Seong-Wook and Sullenger, Bruce. "Isolation of a nuclease-resistant decoy RNA that can protect human acetylcholine receptors from myasthenic antibodies." Nature Biotechnology, 15 (1997): 41-45. |