To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
451 | D-Tryptophan (MF-10) | Small Organic | D-Tryptophan | 153 | 18 nM | Column Buffer (4 mM Mg2+, 250 mM NaCl, 50 mM Tris C1 (pH 7.6)) Binding Buffer is (250 mM NaCl, 4 mM MgCl2, 50 mM Tris (pH 7.6)) Elution Buffer (20 mM EDTA (pH 8.0)) | 53.59% | 5' AGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGUUGGCGUUGGCAUGACGCGGGGAAUCGGGUGCAUCGAUGACUACUCCUGGGCCCACGUCUGUUGUUGACGUCACAGCUUGAUUUAGGAUAGCGCUUGGGCAGUCGUGCAGUGGA 3' | Famulok and Szostak. "Stereospecific Recognition of Tryptophan Agarose by in Vitro Selected RNA." Journal of American Chemical Society, 114 (1992): 3990 |
452 | Fibrinogen (85A) (T-Modified) | Protein | Fibrinogen | 90 | 6.2 µM | 300 mM NaCl, 5 mM MgCl2, 20 mM Tris-HCl at pH 7.6 | Not mentioned in dB, calculate | 5' CCTTCGTTGTCTGCCTTCGTAGCGGATCGAATTACGCGTTAACGGCAACCGATAACGGGACCGATTGCACACCCTTCAGAATTCGCACCA 3' | Li M., Huanh Z., Du L., Altier C., Fang H., Wang B. 2008. Selecting Aptamers for a Glycoprotein through the Incorporation of the Boronic Acid Moiety. Journal of American Chemical SOciety 138(38): 12636-12638. |
453 | Lup an 1 allergen ?-conglutin (SGQ) | Protein | ?-conglutin | 11 | 0.58 nM | Binding Buffer: 10 mM phosphate, 138 mM NaCl, 2.7 mM KCl, 1.5 mM MgCl2, pH 7.4 | 81.82% | 5' GGTGGGGGTGG 3' | P Polo. Selection, characterisation and analytical application of DNA aptamer against the anaphylactic toxic allergen, ?-conglutin, Lup an 1. (Doctoral Thesis). Retrieved from Tesis Doctorals en Xarxa |
454 | Thrombin (15mer) | Protein | Thrombin | 15 | 84 nM | Selection Buffer: (20 mM Tris-acetate pH 7.4, 40mM NaCl, 5mM KCl, 1mM CaCl2, 1mM MgCl2) | 60.00% | 5' GGTTGGTGTGGTTGG 3' | (A) Bock, Louis, et al. "Selection of single-stranded DNA molecules that bind and inhibit human thrombin." Nature 355, (1992): 564-566. (B) S Uehara et al. 30 Poly(dA)-Tailed Thrombin DNA Aptamer to Increase DNase-Resistance and Clotting Inhibitory Activity. Bull. Chem. Soc. Jpn. 81(2008): 1485??1491 |
455 | Lead (Pb) binding aptamer | Other | Lead (Pb) | 15 | 1 nM | pH 7.0, 20 mM NaNO3, 8 mM Tris nitrate, 100 ?M NaCN, 25 °C | 60.00% | 5' GGTTGGTGTGGTTGG 3' | B-F Ye et al. "Colorimetric photonic hydrogel aptasensor for the screening of heavy metal ions." Nanoscale 4(2012): 5998-6003. |
456 | HIV-1 TAR RNA Hairpin Loop | Small Organic | HIV-1 TAR RNA Hairpin Loop | 19 | 50 nM | R buffer (20 mM HEPES (pH 7.4), 140 mM potassium acetate, 20 mM sodium acetate, 3 mM magnesium acetate) | 57.89% | 5' CCCTAGTTAGCCATCTCCC 3' | Sekkai et al. "In Vitro Selection of DNA Aptamers Against the HIV-1 TAR RNA Hairpin." Antisense and Nucleic Acid Drug Development, 12 (2002): 265-274. |
457 | Ampicillin (AMP17) | Small Organic | Ampicillin | 19 | 13.4 nM | Binding Buffer: 20mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM KCl, 5 mM MgCl2. | 68.42% | 5' GCGGGCGGTTGTATAGCGG 3' | Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161 |
458 | Ampicillin (AMP18) | Small Organic | Ampicillin | 19 | 9.8 nM | Binding Buffer: 20mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM KCl, 5 mM MgCl2. | 42.11% | 5' TTTAGTTGGGGTTCAGTTG 3' | Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161. |
459 | Peroxidase DNAzyme | Protein | Hemin | 20 | 29 nM | Binding buffer: 20 mM Tris-AcOH (pH 8.0), 100 mM NaCl, 200 mM KCl, 5 mM MgCl2, 0.5% Triton X-100, and 5% DMSO. | 60.00% | 5' ATTGGGAGGGATTGGGTGGG 3' | Zhu L, et al. (2012) In vitro selection of highly efficient G-quadruplex-based DNAzymes. Anal. Chem. 84: 8383-8390. |
460 | Anti -?1-Adrenergic Receptor-Autoantibodies (Aptamer 110) | Protein | ?1-Adrenoceptor Autoantibodies(AABs) | 21 | n/a nM | Buffer 1: Tris buffer pH 7.3, 0.1% Tween-20, DMEM, 0.1% Tween-20 Buffer 2: Phosphate buffer pH 7.5, 0.1% Tween-20 | 57.14% | 5' ACAGTAACCGCGTGAGGTCGA 3' | Haberland, A., et al. "Aptamer Neutralization of Beta1-Adrenoceptor Autoantibodies Isolated From Patients With Cardiomyopathies." Circulation Research, 109 (2011): 986-992. |