To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 541 | Beta-Estradiol Aptamer (BES.1) | Small Organic | Beta-Estradiol (Estrogen) | 48 | 6 µM | 1X Binding Buffer: 20 mm Tris (pH 7.4), 1 M NaCl, 10 mM MgCl2 | 58.33% | 5' GGCTCTCGGGACGACATGGATTTTCCATCAACGAAGTGCGTCCGTCCC 3' | Yang K, Pei R, Stefanovic D, Stojanovic M.N. (2011) Optimizing Cross-reactivity with Evolutionary Search for Sensors. J. Am. Chem. Soc.134:1642-1647. |
| 542 | hVap1_Stem | Protein | VEGF | 48 | 5.6 nM | APBB; 10 mM HEPES, pH 7.9, 125 mM NaCl, 25 mM KCl, and 1 mM MgCl2 | 56.25% | Meng, Hsein-Wei, and John Pagano. "Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface." Plos-One 9.3 (2014): 1-12. Print. | |
| 543 | L-Tyrosinamide (pe35) | Small Organic | L-Tyrosinamide | 49 | 45 nM | Binding Buffer (20 mM Tris (pH 7.6), 300 mM NaCl, 5 mM MgCl2) | 55.10% | 5' AATTCGCTAGCTGGAGCTTGGATTGATGTGGTGTGTGAGTGCGGTGCCC 3' | Vianini et al. "In vitro selection of DNA aptamers that bind L-tyrosinamide." Bioorganic & Medicinal Chemistry, 9 (2001): 2543-2548. |
| 544 | DNA Blocker (Part of Lysozyme Aptasensor) | Other | Lysozyme | 49 | 0.1 fM | NEBuffer 2(10X): 50 mM NaCl, 10 mM Tris-HCL, 10 mM MgCl2 1 mM dithiothreitol, pH 7.9. | 44.90% | 5' ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAGCCCGTGA 3' | Fu et al. "An ultrasensitive peroxidase DNAzyme-associated aptasensor that utilizes a target-triggered enzymatic signal amplification strategy." Chemical Communications, 47(2011): 9876-9878. |
| 545 | L-Selectin (LD201t1) | Protein | L-Selectin binding to sialyl Lewis X | 49 | 3 nM | Binding Buffer (20 mM Hepes, 111 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 5 mM KCl, 8.9 mM NaOH final pH 8) and 1% globulin-free BSA. | 46.94% | 5' TAGCCAAGGTAACCAGTACAAGGTGCTAAAACGTAATGGCTTCGGCTTAC 3' | Hicke, Brain, et al. "DNA Aptamers Block L-Selectin Function In Vivo Inhibition of Human Lymphocyte Traf?cking in SCID Mic." Journal of Clinical Investigation, 98 (1996): 2688-2692 |
| 546 | L-Selectin Multivalent Aptamer | Protein | L-Selectin | 49 | 0.75 nM | PBS | 46.94% | Chang EK, Eckert MA, Ali MM, Riazifar H, Pone EJ, Liu L, et al. (2015) Facile Supermolecular Aptamer Inhibitors of L-Selectin. PLoS ONE 10(3): e0123034. doi:10.1371/journal.pone.0123034 | |
| 547 | Histone H4 N-terminal tail (4.33) | Protein | H4 N-terminal tail | 50 | 1.3 nM | Low-salt conditions: 100 mM NaCl, 5 mM MgCl2, and 10 mM HEPES (pH 7.5). | 60.00% | 5' TGGTGGGGTTCCCGGGAGGGCGGCTACGGGTTCCGTAATCAGATTTGTGT 3' | Yu et al. "Aptamers can Discriminate Alkaline Proteins with High Specificity." Chem. Biochem. , 12(2011): 2659-2666. |
| 548 | Digoxin (Truncated D1) | Protein | Digoxin | 50 | 0.05 nM | Selection Buffer: 100 mM NaCl, 20 mM Tris-HCl (pH 7.6), 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween 20. | 62.00% | 5' AGCGAGGGCGGTGTCCAACAGCGGTTTTTTCACGAGGGAGGTTGGCGGTGG 3' | Z Kiani et al. In vitro selection and characterization of deoxyribonucleic acid aptamers for digoxin. Analytica Chimica Acta 748(2012): 67-72. |
| 549 | Phorate (SS4-54) | Small Organic | Phorate | 54 | 1.43 µM | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 46.30% | 5' AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
| 550 | Profenofos (SS4-54) | Small Organic | Profenofos | 54 | 1.25 µM | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 46.30% | 5' AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |