To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 421 | L-Arginine (ag.06) | Small Organic | L-Arginine | 97 | 330 nM | Binding buffer: 250 mM NaCl, 50 mM TrisHCl (pH 7.6), 5 mM MgCl2 | 55.67% | 5' GGAGCUCAGCCUUCACUGCAUGAUAAACCGAUGCUGGGCGAUUCUCCUGAAGUAGGGGAAGAGUUGUCAUGUAUGGGGGCACCACGGUCGGAUCCUG 3' | Geiger, Albert, et al. "RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity." Nucleic Acid Research, 24 (1996): 1029-1036. |
| 422 | NF-kappa B | Protein | NF-kappa B | 97 | 1 nM | Buffer A (20 mM HEPES (pH 7.5), 0.4 M NaCl, 2 mM EDTA, 5% v/v glycerol, 1 mM DTT, 0.5 mM PMSF, 1 ug/mL pepstatin, 1 ug/mL leupeptin) Buffer B (20 mM HEPES (pH 7.5), 2 mM EDTA, 5% v/v glycerol, 1 mM DTT, 0.5 mM PMSF, 1 ug/mL pepstatin, 1 ug/mL leupeptin) Selection Buffer (10 mM HEPES (pH 7.5) 0.1 M NaCl, 1 mM DTT) | 41.24% | 5' GGGAUAUCCUCGAGCAUAAGAAACAAGAUAGAUCCUGAAACUGUUUUAAGGUUGGCCGAUCUUCUGCUCGAGAAUGCAUGAAGCGUUCCAUAUUUUU 3' | Lebriska and Maher. "Selection and Characterization of an RNA Decoy for Transcription Factor NF-B." Journal of Biochemistry, 38(1999): 3168-3174. |
| 423 | Co2+ (AR1) | Small Organic | Co2+ | 98 | ~100 µM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 54.08% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341. |
| 424 | Cd2+ (AR1) | Small Organic | Cd2+ | 98 | ~100 µM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 54.08% | ||
| 425 | Ni2+ (AR1) | Small Organic | Ni2+ | 98 | ~100 µM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 54.08% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341. |
| 426 | Zn2+ (AR1) | Small Organic | Zn2+ | 98 | ~100 µM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 54.08% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341 |
| 427 | Mn2+ (AR1) | Small Organic | Mn2+ | 98 | ~1 mM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 54.08% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGAAAGCCAAAGCCGUAGCGCAGAUGAUCUCGCCAUCAGUACCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341. |
| 428 | HER-2 (S6) | Cells | HER-2 | 98 | 94.6 nM | Binding buffer: 4.5 g/L glucose, 5 mM MgCl2, 0.1 mg/mL yeast tRNA, 1 mg/mL BSA in Dulbeccos PBS. | 51.02% | 5' GGGAGAUACCAGCUUAUUCAAUUUGGAUGGGGAGAUCCGUUGAGUAAGCGGGCGUGUCUCUCUGCCGCCUUGCUAUGGGGAGAUAGUAAGUGCAAUCU 3' | Kang, H. (2009). Isolation of RNA aptamers targeting Her-2-overexpressing breast cancer cells using cell-selex. Bull. Korean Chem. Soc., 30(8), 182-1831. |
| 429 | Activated Protein C (APC 99) | Protein | Human Activated Protein C | 99 | 137 nM | Binding Buffer: 10 mM sodium citrate, 150 mM KCl (pH 7.6). | 62.63% | 5' GUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCU 3' | Gal, S., et al. "Selection of a RNA aptamer that binds to human activated protein C and inhibits its protease function." European Journal of Biochemistry, 252(1998): 553-562. |
| 430 | Caffeine (S2.caf.D11) | Protein | Caffeine | 99 | 1mM | Selection Buffer (500 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 10 mM sodium phosphate, 90 mM HEPES (pH 7.5)) Assay Buffer (180mM HEPES (pH 7.0±8.0), 300 mM NaCl, 20 or 50 mM MgCl2, 2 mM EDTA, 20 mM Na phosphate), r.t. | 51.52% | 5' GGAUGUCCAGUCGCUUGCAAUGCCCUUUUAGACCCUGAUGAGGAUCAUCGGACUUUGUCCUGUGGAGUAAGAUCGCGAAACGGUGAAAGCCGUAGGUCU 3' | Ferguson et al. "A novel strategy for selection of allosteric ribozymes yields RiboReporter TM sensors for caffeine and aspartame." Nucleic Acids Research, 32(2004): 1756-1766 |