To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
381 | Kanamycin A (sla 16) (ID# 154) | Small Organic | Kanamycin A | 80 | 300 nM | nding Buffer (500 mM NaCl, 50 mM Tris (pH 7.6)) | 57.50% | 5' GGGAAUGGAUCCACAUCUACGAAUUCACCGCGGGGUUGCGGACCGGGAGCUCCAGCUUCACUGCAGACUUGACGAAGCUU 3' | Lato et al. "In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution." Chemistry & Biology, 2(1995): 291-303. |
382 | Phenylalanine (ID# 158) | Small Organic | Phenylalanine | 80 | 34 µM | Selection Buffer (50 mM Hepes (pH 7.0), 0.3 M NaCl, 5 mM CaCl2, and 5 mM MgCl2) | 50.00% | 5' AUUGGAUCGGUAGUAUUUAGGGUGAGACACUUCAUGCCUUUGUUGCAGGCUGGGGUGAAGGCGCUACAUGGCGUCUGAAA 3' | Illangasekare and Marus. "Phenylalanine-Binding RNAs and Genetic Code Evolution." Journal of Molecular Evolution, 54(2002): 298-311. |
383 | Interleukin 10 (IL-10) (R5A1) (ID# 291) | Protein | Interleukin -10 (IL-10) | 80 | 12 nM | 150 mmol/L NaCl, 20 mmol/L KCl, and 2 mmol/L HEPES heated to 82°C and slowly cooling to room temperature | 56.25% | 5' GGGCUCAUGCACGUUUGCUCCUGUAAUUGGCGUAUGUAACCCAGGCACCAAACACCCCAGGCCGGGCCAUGAUCCACAUA 3' | Berezhnoy, A, et al. (2012). Isolation and optimization of murine il-10 receptor blocking oligonucleotide aptamers using high- throughput sequencing. The American Society of Gene & Cell Therapy |
384 | Anti-NF-kB p65 (R2) (ID# 388) | Protein | NF-kB p65 | 80 | 25 nM | Selection buffer: 10mM HEPES at pH 7.5, 100mM NaCl, 1mM DTT | 51.25% | 5' GAAGCUUUCACACAACAAGGCCCGGGACUGUAUUAGGGAAAUUAGAGUACAGACAGUCGCCGUGGGUCGAAUUCCGCUCA 3' | Wurster, S. E, and Maher, L. J. "Selection and characterization of anti-NF-kB p65 aptamers." RNA, 14(2008): 1037-1047. |
385 | ATP-inhibited molecular switch (ID# 399) | Small Organic | ATP | 80 | na nM | Reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr | 60.00% | 5' GGGCGACCCUGAUGAGAUGGGGAAGAAACUGUGGCACUUCGGUGCCAGCCUCUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' | Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589. |
386 | Kanamycin A (sla 110) (ID# 466) | Protein | Kanamycin A | 80 | <300 nM | Binding Buffer (500 mM NaCl, 50 mM Tris Cl (pH 7.6)) | Binding Buffer (500 mM NaCl, 50 mM Tris Cl (pH 7.6)) | 5' GGGAAUGGAUCCACAUCUACGAAUUCGAAUUGCCGUAAUUUCCCGUGGAGCGAUGCUUCACUGCAGACUUGACGAAGCUU 3' | Lato et al. "In vitro selection of RNA lectins: using combinatorial chemistry to interpret ribozyme evolution." Chemistry & Biology, 2(1995): 291-303. |
387 | Histone H3R8Me2sym (Clone 1) (ID# 224) | Peptide | Histone H3R8Me2sym | 81 | 12 nM | N/A | 64.20% | 5' GGGACGCGUGGUACCGAUGGGUCAGCAUGUAGCCAGGCAGGGCCGUGUGAGCUUGUGCUGAUGUGAGCUUCCGCGGGGAUC 3' | Hyun et al. "An RNA Aptamer That Selectively Recognizes Symmetric Dimethylation of Arginine 8 in the Histone H3 N-Terminal Peptide." Nucleic Acid Therapeutics, 21 (2011): 157-163. |
388 | ß-Catenin (ID# 468) | Protein | Arm 1-12 of B-catenin | 81 | 5 nM | Binding buffer: 25 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl2, 2 mM DTT, and 40 U RNase inhibitor. | 56.79% | 5' GGACGCGUGGUACCAGGCCGAUCUAUGGACGCUAUAGGCACACCGGAUACUUUAACGAUUGGCUAAGCUUCCGCGGGGAUC 3' | Lee HK, Choi YS, Park YA, et al. (2006) Modulation of oncogenic transcription and alternative splicing by beta-catenin and an RNA aptamer in colon cancer cells. |
389 | ATP-induced molecular switch (ID# 393) | Small Organic | ATP | 81 | NA nM | reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr | 60.49% | 5' GGGCGACCCUGAUGAGCCUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCACGUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' | Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589. |
390 | CAP/CAM Aptamer (ID# 629) | Other | Chloramphenicol | 81 | 7.7 µM | 100 mM NaCl, 20 mM TrisHCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, pH 7.6 | 58.02% | 5' AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAGCCTATGCGTGCTACCCGTGAA 3' | Mehta J, Van Dorst B, Rouah-Martin E, et al. (2010) In vitro selection and characterication of DNA aptamers recognizing chloramphenicol. Journal of Biotechnology 155: 361-369. |