# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
41 Bacillus anthracis spores (Ba) Other Bacillus anthracis spores 80 1.5x10^12 CFU/mL Reaction buffer: 350 uL 2 M Tris-HCl, 100 uL 1 M MgCl2, 7.7 mg dithiothreitol, and water 53.75% 5'-ACCCCTGCATCCTTTGCTGGAGAGGAATGTATAAGGATGTTCCGGGCGTGTGGGTAAGTCAGTCTAGAGGGCCCCAGAAT-3' Fan, M. et al. "Aptamer selection express: A novel method for rapid single-step selection and sensing of aptamers." Journal of Biomolecular Technologies, 19 (2008): 311-321
42 Mycoplasma bovis detection aptamer (WKB-14) Protein P48 of M. Bovis 80 15.61 nM Added to wells of plate coated with P48 protein solution (P48 protein dissolved in 100 uL of 0.05 carbonate-bicarbonate buffer) 48.75% 5’-GCTGCAATACTCATGGACAGGTTGCGAAAGACAACGAATGCTTTGCCTGCCATAATTTGCGTCTGGAGTACGACCCTGAA-3’ Fu, P., et. al. Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum.
43 Aflatoxin B1 Aptamer Small Organic Aflatoxin B1 80 11.39 nM pH 7.0: 100 mmol/L NaCl, 20 mmol/L Tris–HCl pH 7.6, 2 mmol/L MgCl2, 5 mmol/L KCl, 1 mmol/L CaCl2, 0.02 % Tween 20 55.00%
44 Aptamer ID 1  Protein PDGF-BB 80 2.7 nM 0.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2 (PBSM), pH 7.4 52.50% 5’-TCCCACGCATTCTCCACATCATAAGCTGAGCATCTTAGATCCCCGTCAAGGGCAGCGTAA CCTTTCTGTCCTTCCGTCAC-3’ Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/
45 Aptamer ID 2 Protein PDGF-BB 80 2.5 nM 0.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2 (PBSM), pH 7.4 52.50% 5’-TCCCACGCATTCTCCACATCGATACTGAGCATCGTACATGATCCCGCAACGGGCAGTATT CCTTTCTGTCCTTCCGTCAC-3’ Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/
46 Aptamer ID 3 Protein PDGF-BB 80 2.6 nM 0.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2 (PBSM), pH 7.4 56.25% 5’-TCCCACGCATTCTCCACATCAGTTGAATGGTGTGGTCACTTCCAGTCCCGCAGGGCACACCCTTTCTGTCCTTCCGTCAC-3’ Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/
47 A1  Protein Staphylococcus aureus enterotoxin A (SEA) 80 92.17 nM 20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 • 6H2O, pH 7.4 48.75% 5’-AGCAGCACAGAGGTCAGATGAGGCGATTACGCTTCTTGTACTTCAATAACGACTCAACTCCCTATGCGTGCTACCGTGAA-3’ Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697.
48 A15 Protein Staphylococcus aureus enterotoxin A (SEA) 80 48.57 nM 20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 • 6H2O, pH 7.4 47.50% 5?-AGCAGCACAGAGGTCAGATGTACTTATGCATTTCCTCCCACGATCTTATTTGAGAGTGACCCTATGCGTGCTACCGTGAA-3? Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697.
49 A23.2  Protein Staphylococcus aureus enterotoxin A (SEA) 80 235.00 nM 20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 • 6H2O, pH 7.4 38.75% 5?-AGCAGCACAGAGGTCAGATGAAGGTCTTACATCAATTTATATATTTTTCCAATATCTGTCCCTATGCGTGCTACCGTGAA-3? Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697.
50 Leptin (Lep3) Protein Leptin 81 0.32 ΅M TGK 1X: 25 mM Tris, 192 mM glycine, and 5 mM potassium phosphate (pH 8.3) 56.79% 5'-CTTCTGCCCGCCTCCTTCCGTTAATGGGGGATCTCGCGGCCGTTCTTGTTGCTTATACAGGAGACGAGATAGGCGGACACT-3' Ashley J and Li S FY. (2013) Three-dimensional selection of leptin aptamers using capillary electrophoresis and implications for clone validation. Anal Biochem. 434: 146-152