To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 321 | Cyanocobalamin (35-mer) | Small Organic | Cyanocobalamin | 35 | 88 nM | Column Buffers (1 M LiC1, 5 mM MgC12, and 25 mM HEPES (pH 7.4) or 1 M NaCl, 5 mM MgC12, and 25 mM HEPES (pH 7.4)) | 60.00% | 5' CCGGUGCGCAUAACCACCUCAGUGCGAGCAAGGAA 3' | Lorsch and Szostak. "In vitro selection of RNA aptamers specific for cyanocobalamin." Biochemistry, 33 (1994) |
| 322 | E. Coli 5S RNA | Small Organic | E. Coli 5S RNA | 37 | 3 µM | Binding buffer: 30 mM Tris–acetate(pH 7.5), 60 mM magnesium acetate, 120 mM potassium acetate, and 120 mM ammonium acetate | 56.76% | 5' GGUGAUACCGCCCAAGAGUUCAUAUCGACGGCGGUGU 3' | Ko, J. et al. "Identification of a structural motif of 23S rRNA interacting with 5S rRNA." FEBS Letters, 508 (2001) |
| 323 | Endothelial Integrin Alpha-V Beta-3 | Protein | Alpha-V Beta-3 | 37 | N/A nM | Washed with PBS and 0.9 mM CaCl2, 0.5 mM MgCl2, 2.67 mM KCl, 1.47 mM KH2PO4, 135 mM NaCl, and 8 mM Na2. | 51.35% | 5' UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC 3' | Brunette et al. "RNA Aptamer Therapy for Vaso-Occlusion in Sickle Cell Disease." Nucleic Acids Therapeutics, 21(2011) |
| 324 | HIV-1 Tat protein | Protein | HIV-1 Tat protein | 37 | 120 pM | Binding Buffer: 50 mM Tris-HCl (pH 7.8) and 50 mM KCl | 56.76% | 5' ACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA 3' | R Yamamoto et al. A novel RNA motif that binds efficiently and specifically to the Tat protein of HIV and inhibits the trans-activation by Tat of transcription in vitro and in vivo. Genes to Cells 5(2000) |
| 325 | Malachite Green (MG-4) | Small Organic | Malchite Green | 38 | 1 µM | Selection buffer: 0.1 M KCl, 5 mM MgCl2, 10 mM Na-HEPES (pH 7.4) | 60.53% | 5' GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC 3' | Grate, Dilara and Wilson, Charles. "Laser-mediated, site-specific inactivation of RNA transcripts." PNAS, 96 (1999) |
| 326 | Theophylline (mTCT8-4) | Small Organic | Theophylline | 38 | 100 nM | Buffer A (100 mM Hepes (pH 7.3), 5 mM MgCI2, and 0.5 M NaCI) | 52.63% | 5' AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU 3' | Jenison et al. "High-resolution molecular discrimination by RNA." Science, 263(1994) |
| 327 | ATP (ATP-40-1) | Small Organic | ATP | 40 | 700 nM | Binding Buffer (300mM NaCl, 20 mM Tris (pH 7.6), 5mM MgCl2) | 60.00% | 5' GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC 3' | sassanfar and Szostak. "An RNA motif that binds ATP." |
| 328 | L-Histidine (His 945) | Small Organic | L-Histidine | 40 | 12 nM | Selection Buffer (50 mM Hepes (pH 7.0), 250 mM NaCl, 5 mM each CaCl2 and MgCl2, and 1 mM glycine) | 52.50% | 5' GGCAUCGGAAAGUGGGUUGAUGUAAGUAACAGGCGAUGCC 3' | Majerfeld, et al. "RNA A?nity for Molecular L-Histidine; Genetic Code Origins." Journal of Molecular Evolution, 61 (2005 |
| 329 | HIV-1 Nuceocapsid | Protein | HIV-1 Nuceocapsid | 40 | 2.3 nM | Binding Buffer (50 mM Tris, pH 7.5, 100 mM NaCl, 1 mM MgCl2, 30 µM ZnCl and 10 mM DTT) SSC buffer (17.5 mM sodium citrate (pH 7.0), 150 mM sodium chloride) | 57.50% | 5' GGAGACAUCCCUCUUGUUGGUGGUGCCGUGUGGAUGUCUC 3' | Berglund, A., et al. "A High Affinity Binding Site for the HIV-1 Nucleocapsid Protein." Nucleic Acids Research, 25(1997) |
| 330 | S132B-C22 | Protein | Botulinum Neuroxin Type A | 40 | 0.8 nM | PBS, pH 7.4, 300mM NaCl, 3mM MgCl2, 5mM DTT, 1mg/ml BSA, 0.2% Tween, 1mg/ml heparin | 60.00% | Tzuu-Wang Chang, Michael Blank, Pavithra Janardhanan, Bal Ram Singh, Charlene Mello, Michael Blind, Shuowei Cai, "In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin" Biochemical and Biophysical Research Communications 396 (2010) |