# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
321 Cyanocobalamin (35-mer) Small Organic Cyanocobalamin 35 88 nM  Column Buffers (1 M LiC1, 5 mM MgC12, and 25 mM HEPES (pH 7.4) or 1 M NaCl, 5 mM MgC12, and 25 mM HEPES (pH 7.4)) 60.00% 5' CCGGUGCGCAUAACCACCUCAGUGCGAGCAAGGAA 3' Lorsch and Szostak. "In vitro selection of RNA aptamers specific for cyanocobalamin." Biochemistry, 33 (1994)
322 E. Coli 5S RNA Small Organic E. Coli 5S RNA 37 3 µM  Binding buffer: 30 mM Tris–acetate(pH 7.5), 60 mM magnesium acetate, 120 mM potassium acetate, and 120 mM ammonium acetate 56.76% 5' GGUGAUACCGCCCAAGAGUUCAUAUCGACGGCGGUGU 3' Ko, J. et al. "Identification of a structural motif of 23S rRNA interacting with 5S rRNA." FEBS Letters, 508 (2001)
323 Endothelial Integrin Alpha-V Beta-3 Protein Alpha-V Beta-3 37 N/A nM Washed with PBS and 0.9 mM CaCl2, 0.5 mM MgCl2, 2.67 mM KCl, 1.47 mM KH2PO4, 135 mM NaCl, and 8 mM Na2. 51.35% 5' UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC 3' Brunette et al. "RNA Aptamer Therapy for Vaso-Occlusion in Sickle Cell Disease." Nucleic Acids Therapeutics, 21(2011)
324 HIV-1 Tat protein  Protein HIV-1 Tat protein 37 120 pM Binding Buffer: 50 mM Tris-HCl (pH 7.8) and 50 mM KCl 56.76% 5' ACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA 3' R Yamamoto et al. A novel RNA motif that binds efficiently and specifically to the Tat protein of HIV and inhibits the trans-activation by Tat of transcription in vitro and in vivo. Genes to Cells 5(2000)
325 Malachite Green (MG-4) Small Organic Malchite Green 38 1 µM Selection buffer: 0.1 M KCl, 5 mM MgCl2, 10 mM Na-HEPES (pH 7.4) 60.53% 5' GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC 3' Grate, Dilara and Wilson, Charles. "Laser-mediated, site-specific inactivation of RNA transcripts." PNAS, 96 (1999)
326 Theophylline (mTCT8-4) Small Organic Theophylline 38 100 nM Buffer A (100 mM Hepes (pH 7.3), 5 mM MgCI2, and 0.5 M NaCI) 52.63% 5' AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU 3' Jenison et al. "High-resolution molecular discrimination by RNA." Science, 263(1994)
327 ATP (ATP-40-1) Small Organic ATP 40 700 nM Binding Buffer (300mM NaCl, 20 mM Tris (pH 7.6), 5mM MgCl2) 60.00% 5' GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC 3' sassanfar and Szostak. "An RNA motif that binds ATP."
328 L-Histidine (His 945) Small Organic L-Histidine 40 12 nM Selection Buffer (50 mM Hepes (pH 7.0), 250 mM NaCl, 5 mM each CaCl2 and MgCl2, and 1 mM glycine) 52.50% 5' GGCAUCGGAAAGUGGGUUGAUGUAAGUAACAGGCGAUGCC 3' Majerfeld, et al. "RNA A?nity for Molecular L-Histidine; Genetic Code Origins." Journal of Molecular Evolution, 61 (2005
329 HIV-1 Nuceocapsid Protein HIV-1 Nuceocapsid 40 2.3 nM Binding Buffer (50 mM Tris, pH 7.5, 100 mM NaCl, 1 mM MgCl2, 30 µM ZnCl and 10 mM DTT) SSC buffer (17.5 mM sodium citrate (pH 7.0), 150 mM sodium chloride) 57.50% 5' GGAGACAUCCCUCUUGUUGGUGGUGCCGUGUGGAUGUCUC 3' Berglund, A., et al. "A High Affinity Binding Site for the HIV-1 Nucleocapsid Protein." Nucleic Acids Research, 25(1997)
330 S132B-C22  Protein Botulinum Neuroxin Type A  40 0.8 nM PBS, pH 7.4, 300mM NaCl, 3mM MgCl2, 5mM DTT, 1mg/ml BSA, 0.2% Tween, 1mg/ml heparin 60.00% Tzuu-Wang Chang, Michael Blank, Pavithra Janardhanan, Bal Ram Singh, Charlene Mello, Michael Blind, Shuowei Cai, "In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin" Biochemical and Biophysical Research Communications 396 (2010)