# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
521 Tumor Endothelial Cells (AraHH001) Cells Mouse and Human Tumour Endothelial Cells (mTECs and hTECs) 40 43.8 nM Selection Buffer: 50 mM Tris-HCl (pH 7.5), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2, 250 mM sucrose and 0.1% sodium azide. 52.50% 5' ACGTACCGACTTCGTATGCCAACAGCCCTTTATCCACCTC 3' Ara N, Hyodo M, Ohga N, Hida, N, Harishima H. (2012) Development of a novel DNA aptamer ligand targeting to primary cultured tumor endothelial cells by a cell-based SELEX method. PLOS one 7: e50174.
522 Celiac disease Aptamer (Gli4)  Peptide 33-mer (immunodominant peptide from alpha2-gliadin) 40 61 nM 50 mM TRIS-HCl, 0.25 M NaCl, 5mM MgCl2 57.50% Gonzalez, S, et. al. "Aptamer Binding to Celiac Disease-Triggering Hydrophobic Proteins A Sensitive Gluten Detection Approach." 2014. Analytical Chemistry 86: 2733-39.
523 CCFM641-5 Protein Unknown Membrane Protien 40 10.69 +/- 0.89 nM PBS at 37 C for 45 min with slight agitation 67.50% 5' TGCGTGAGCGGTAGGCCCCTACGACCCACTGTGGTTGGGC 3' Hu, Lujun, et al. "Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum" International Journal of Molecular Sciences 10.3390(2017): 833.
524 Myo40-7-27 Protein Myoglobin 40 4.93 nM 20 mM Hepes, 120 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1mM MgCl2, pH 7.3 55.00% 5' CCCTCCTTTCCTTCGACGTAGATCTGCTGCGTTGTTCCGA 3' Wang, Q., et al. ƒ??Sensitive point-of-care monitoring of cardiac biomarker myoglobin using aptamer and ubiquitous person glucose meter.ƒ? Biosensors and Bioelecgtronics, 64 (2015): 161-164. Wang, Q., et al. ƒ??Screening of DNA Aptamers against Myoglobin Using a Positive and Negative Selection Units Integrated Microfluid Chip and its Biosensing Application.ƒ? Analytical Chemistry, 86 (2014): 6572-6579.
525 C5s Anti-Antibody Antibody Anti-Vesicular Stomatitis Antibody 40 n/a nM 90% High Glucose DMEM, 10% Fetal Bovine Serum. Tested in vivo. 72.50% 5' ACTAGGACGCTTGGGAGGGGGGGTGGGGTGTCCGGTCGCG 3' Muharemagic D, Zamay A, Ghobadloo SM, Evgin L, Savitskaya A, et al. (2014) Aptamer-Facilitated Protection of Oncolytic Virus from Neutralizing Antibodies. Molecular Therapy--Nucleic Acids 3, e167. doi: 10.1038/mtna.2014.19
526 Cellobiose Small Organic Cellobiose 41 600 nM Binding buffer: 20 mM Tris (pH 7.5), 100 mM NaCl, 5 mM MgCl2 78.05% 5' GCGGGGTTGGGCGGGTGGGTTCGCTGGGCAGGGGGCGAGTG 3' Yang, Q., et al. "DNA ligands that bind tightly and selectively to cellobiose." PNAS, 95 (1998): 5462-5467.
527 Daunomycin (10.10v) Small Organic Daunomycin 41 272 nM Binding Buffer ((20 mM Tris–HCl [pH 7.4], 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 0.05% [v/v] Tween 20) 58.54% 5' ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT 3' Wochner, et al. "A DNA aptamer with high affinity and specificity for therapeutic anthracyclines." Analytical Biochemistry, 373(2008): 34-42.
528 HIV-1 Reverse Transcriptase (R1T) Protein HIV-1 RT 41 1.1 nM 50 mM Tris-HCl, pH 8.0, 80 mM KCl, 6 mM MgCl2, and 1 mM DTT. 63.41% 5' CGCCTGATTAGCGATACTCAGCGTTGGGTGGGTGGGTGGG 3' (A) D Michalowski et al. Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases. Nucleic Acid Res. 36(2008): 7124-7135. (B) Y-T Lai and J DeStefano. DNA aptamers to human immunodeficiency virus reverse transcriptase selected by a primer-free SELEX method: characterization and comparison with other aptamers. Nucleic Acid Therapeutics 22(2012): 162-176
529 CCRF-CEM (sgc8c) Cells Acute lymphoblastic leukemia (CCRF-CEM) 41 0.78 nM Binding buffer: 0.1mg/ml yeast tRNA and 1 mg/ml BSA into wash buffer (4.5g/L glucose, 5 mM MgCl2 in Dulbecco's PBS with CaCl2 and MgCl2) 51.22% 5' ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 3' (A)Shangguan et al. "Optimization and Modifications of Aptamers Selected from Live Cancer Cell Lines." Chem. Biochem., 8, (2007): 603-6. (B) Y-F Huang et al. Molecular assembly of an aptamer-drug conjugate for targeted drug delivery to tumor cells. Chembiochem. 10(2009):862-868
530 Anti Lung Carcinoma ( EJ4) Cells Lung Adenocarcinoma (H23) 41 60 nM 0.45% w/v glucose 5 mM MgCl2 in PBS 1 mg/mL tRNA 1 mg/mL BSA incubate with cells for 30 minutes 53.66% 5' GAAGACGAGCGGCGAGTGTTATTACGCTTGGAAACAACCCC 3' Jimenez et al. Generation of Lung Adenocarcinoma DNA Aptamers for Cancer Studies (PLOSone)