# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
11 AraHH001 Protein Cardiac Troponin T (cTnT) 40 NA Not available 52.50% 5'ACGTACCGACTTCGTATGCCAAC AGCCCTTTATCCACCTC3' Xiaolin Yang, Ying Zhao, Lijuan Sun, Honglan Qi, Qiang Gao, Chengxiao Zhang. Sensors and Actuators B: Chemical. Electrogenerated chemiluminescence biosensor array for the detection of multiple AMI biomarkers (2017). https://doi.org/10.1016/j.snb.2017.10.108
12 G5a3N.4 Protein HPV-16E7 protein 75 1.9 µM 1X PBS 40.00% 5’-TAATACGACTCACTATAGGGAGACCCAAGCCGATTTATTTTGTGCAGCTTTTGTTCCCTTTAGTGAGGGTTAATT-3’ Julia D. Toscano-Garibay, Maria L. Benitez-Hess, and Luis M. Alvarez-Salas. 2011. Isolation and Characterization of an RNA Aptamer for the HPV-16 E7 Oncoprotein. Archives of Medical Research 42 (2011) 88-96
13 Tetracycline Small Organic Tetracycline 76 63.6 nM  Binding Buffer: 100 mM NaCl, 20 mM Tris-HCl (pH 7.6), 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, 0.02% Tween-20 68.42% 5’-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG-3’ Niazi JH, Lee SJ, Gu MB. (2008) Single-stranded DNA aptamers specific for antibiotics tetracyclines. Bioorg Med Chem. 16: 7245-7253
14 RBP4 binding aptamer Protein Retinol-binding protein-4 (RBP4) 76 201 nM Binding Buffer: 100 mM NaCl, 25 mM Tris-HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween-20, pH 7.6. 47.37% 5’-ATACCAGCTTATTCAATTACAGTAGTGAGGGGTCCGTCGTGGGGTAGTTGGGTCGTGGAGATAGTAAGTGCAATCT-3’ SJ Lee et al. Sensitive detection of adipokines for early diagnosis of type 2 diabetes using enzyme-linked antibody-aptamer sandwich (ELAAS) assays. Sensors Actuat. B-Chem.(2012): 243-248.
15 Nampt binding aptamer (NBA) Protein Nampt/Nicotinamide phosphoribosyltransferase 75 72.52 nM Binding Buffer: 100 mM NaCl, 25 mM Tris-HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween-20, pH 7.6. 47.37% 5’-ATACCAGCTTATTCAATTGGGCGGTGGGGGGGGTAGTGGGTGTTATGGCGATCGTGGAGATAGTAAGTGCAATCT-3’ Park, J.-W., Tatavarty, R., Kim, D. W., Jung, H.-T., & Gu, M. B. (2012). Immobilization-free screening of aptamers assisted by graphene oxide. Chem. Commun., 48(15), 2071–2073. doi:10.1039/c2cc16473f SJ Lee et al. Sensitive detection of adipokines for early diagnosis of type 2 diabetes using enzyme-linked antibody-aptamer sandwich (ELAAS) assays. Sensors Actuat. B-Chem.(2012): 243-248
16 U2  Cells U87-EGFRvIII 76 3.37 nM 0.45 g of glucose, 10 mg yeast tRNA, 5 mg salmon sperm DNA, 0.1 g BSA and 0.5 ml of 1 M MgCl2 in 100 ml of 1X phosphate-buffered saline [PBS] 47.37% 5’-ATCCAGAGTGACGCAGCATTTTGACGCTTTATCCTTTTCTTATGGCGGGATAGTTTCGTGGACACGGTGGCTTAGT-3’ Wu, X. et al. "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.
17 U8 Cells U87-EGFRvIII 76 4.35 nM 0.45 g of glucose, 10 mg yeast tRNA, 5 mg salmon sperm DNA, 0.1 g BSA and 0.5 ml of 1 M MgCl2 in 100 ml of 1X phosphate-buffered saline [PBS] 39.47% 5’-ATCCAGAGTGACGCAGCATGAATCTTTTCTTTTGGTTTTGATATTTATAGTTGGTGAATGGACACGGTGGCTTAGT-3’ "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.
18 U19 Cells U87-EGFRvIII 76 16.7 nM 0.45 g of glucose, 10 mg yeast tRNA, 5 mg salmon sperm DNA, 0.1 g BSA and 0.5 ml of 1 M MgCl2 in 100 ml of 1X phosphate-buffered saline [PBS] 40.79% 5’-ATCCAGAGTGACGCAGCATTTGTATCCTATTTTGTTTATGTAATTGTCGTTGATCATGTGGACACGGTGGCTTAGT-3’ Wu, X. et al. "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.
19 U31 Cells U87-EGFRvIII 76 8.10 nM  0.45 g of glucose, 10 mg yeast tRNA, 5 mg salmon sperm DNA, 0.1 g BSA and 0.5 ml of 1 M MgCl2 in 100 ml of 1X phosphate-buffered saline [PBS] 42.11% 5’-ATCCAGAGTGACGCAGCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGTTGTGGACACGGTGGCTTAGT-3’ Wu, X. et al. "Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo." PLOS One 2014, 9:3.
20 EpCAM EP166 Protein EpCAM 77 5.48 nM Binding buffer [4.5 g/L glucose, 5 mM MgCl2 and 10% FBS in Dulbecco’s PBS (Sigma)] Bovine Serum Albumin (1 mg/ml; Thermo Inc., USA) 58.44% 5'-CGCGGAAGCGTGCTGGGCCAACAGAGGGACAAACGGGGGAAGATTTGACGTCGACGACA CATAACCCAGAGGTCGAT-3' Kim, J., W.; Kim, E., Y.; Kim, S., Y; Byun, S., K.; Lee, D.; Oh, K.; Kim, W., K.; Han, B., S.; Chi, S.; Lee, S., C.; Bae, K. Identification of DNA Aptamers toward Epithelial Cell Adhesion Molecule via Cell-SELEX. Molecules and Cells, 2014, 37(10), 742-746 ISSN: 0219-1032