# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
411 Hepatitis C Virus Dependent RNA Polymerase (B.2) Protein Hepatitis C Virus Dependent RNA Polymerase 92 1.5 nM Binding buffer: 20 mM Tris-HCl (pH 7.0), 1 mM dithiothreitol (DTT), 0.25 U/ul RNasin, 100 ng/ul BSA, 250 mM NaCl, 0.03% n-octyl-B-D-glucopyranoside, 5 mM MgCl2, and 2.0% glycerol 67.39% 5' GGGAUGCUUCGGCAUCCCCGAAGCCGCUAUGGACCAGUGGCGCGGCUUCGGCCCGACGGAGUGGUACCGCUUCGGCGGUACGUAAGCUUGGG 3' Biroccio et al. "Selection of RNA Aptamers That Are Specific and High-Affinity Ligands of the Hepatitis C Virus RNA-Dependent RNA Polymerase." J. Virol>, 76 (2002):3688-3696.
412 2F11-14 Protein Ebola Virus VP35 92 7.1 nM 10 mM HEPES (pH 7.0), 150 mM NaCl, 2mM TCEP (tris(2-carboxyethyl)phosphine), and 1 mM MgCl2 and filtered through nitrocellulose membrane 47.83% Binning, J., Wang, T., Luthra, P., et al. (2013) Development of RNA aptamers targeting Ebola Virus VP35. Biochemistry, 52(47):8406-8419. doi: 10.1021/bi400704d
413 Dopamine (dopa2/c.1) Small Organic Dopamine 93 1.6 µM Column Buffer: 50 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 0.5 M or 0.15 M NaCl 58.06% 5' GGGAAUUCCGCGUGUGCGCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCC 3' Mannironi, C., et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-973.
414 HA12-16 Protein gHA1 protein 93 N/A 20 mM sodium phosphate, pH 7.5, 500 mM NaCl, and 20 mM imidazole 50.54% Kwon H-M, Lee KH, Han BW, Han MR, Kim DH, et al. (2014) An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells. PLoS ONE 9(5): e97574. doi:10.1371/journal.pone.0097574
415 Theophylline (AR6) Small Organic Theophylline 94 N/A nM Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2  52.13% 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACGAAACGGUAGCGAGAGCUC 3' Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001):336-341.
416 HA 12-16 Protein HA protein 94 N/A 20 mM sodium phosphate, pH 7.5, 500 mM NaCl and 20 mM imidazole 50.00% Kwon, H. et al. "An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells." PLOS One 2014, 9 1-9.
417 HA12-16 Protein Avian Influenza Glycoprotein Hemagglutinin (gHA1) 94 20 mM sodium phosphate, pH 7.5, 500 mM NaCl, and 20 mM imidazole 50.00% Kwon H-M, Lee KH, Han BW, Han MR, Kim DH, et al. (2014) An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells. PLoS ONE 9(5): e97574. doi:10.1371/journal.pone.0097574
418 Zinc Small Organic Zinc 95 1.2 mM Buffer A (0.4 M NaCl, 20 mM HEPES-Na (pH 7.0), and 1 mM MgCl2) 49.47% 5' GGGAGAGGAUACUACUGUCAUACGUUAGGCUGUAGGCGAGGUGAAAUGAGCGGUAAUAGCCUCAGCGUAGCAUAUGCAUGAAUUCGAAGCUUCGC 3' Ciesiolka et al., "Selection of an RNA domain that binds Zn2+." Journal of RNA, 1(1995): 538-550.
419 Hen Egg White Lysozyme (cyt7-2) Protein Hen Egg White Lysozyme 95 2.5 µM Ligation buffer (50 mM Tris, pH 7.5, 100 mM KCl, 10 mM MgCl2) 49.47% 5' GGACCUCGGCGAAAGCUAACGUCUCAUGGCUAAAUUGCCAUGUUGCUACAAAUGAUAUGACUAGAGAGGUUAGGUGCCUCGUGAUGUCCAGUCGC 3' Robertson and Ellington. "In vitro selection of nucleoprotein enzymes." Nature Biotechnology, 19(2001): 650-655. Hesselberth et al. "Simultaneous detection of diverse analytes with an aptazyme ligase array." Analytical Biochemistry, 312(2003): 106-112.
420 Phosphorylated ERK2 Protein Phosphorylated ERK2 95 N/A nM 34-37 °C, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 0.05 µg/µl tRNA 48.42% 5' GGCGUGACCUGAUGAGUCACGCAGACGCUAGCGAAUUGGUUCCUCGAAAGGGGAAAGCGUUAUUAAGAAACCAAAAUGUGUUACGAAACGUUCCC 3' Vaish et al. "Monitoring post-translational modifications of proteins with allosteric ribozymes." Nature Biotechnology, 20(2002): 810-815.