To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
461 | Ampicillin (AMP4) | Small Organic | Ampicillin | 21 | 9.4 nM | Binding Buffer: 20mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM KCl, 5 mM MgCl2. | 71.43% | 5' CACGGCATGGTGGGCGTCGTG 3' | Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161. |
462 | Anti Aflatoxin M1 | Protein | Aflatoxin M1 | 21 | 0.0182 nM | N/A | 38.10% | 5' ACTGCTAGAGATTTTCCACAT 3' | Nguyen. Label Free detection of Aflatoxin M1 with electrochemical Fe3O4/polyaniline-based aptasensor |
463 | Ky2 Aptamer | Other | Kanamycin | 21 | 78.8 nM | 20mM Tris-HCl, 50mM NaCl, 5mM KCl, 5mM MgCl2, pH 8.0 | 61.90% | Kyung-Mi Song, Minseon Cho, Hunho Jo, Kyoungin Min, Sung Ho Jeon, Taisun Kim, Min Su Han, Ja Kang Ku, Changill Ban, "Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer". Anal. Biochem. 415 (2011) 175-181. | |
464 | Mercury II (Hg2+) | Other | Mercury II (Hg2+) | 22 | 40 nM | 3-(N-morpholino)propanesulfonic acid (10mM, pH 7.0, NaCl (25mM), NaNO3 (500mM), and ethylenediamine (0.1 mM) | 36.36% | 5' TTCTTTCTTCCCCTTGTTTGTT 3' | A. Ono and H. Togashi. "Highly selective oligonucleotide-based sensor for mercury(II) in aqueous solutions." Angew. Chem. Int. Ed. 43(2004):4300-4302. |
465 | Glycated human serum albumin (GHSA) | Protein | GHSA | 23 | 5.78 µM | 1X PBS, 137mM [Na+], 2mM [Mg2+] | 60.87% | 5' TGCGGTTGTAGTACTCGTGGCCG 3' | Apiwat et al. Graphene based aptasensor for glycated albuminin diabetes mellitus diagnosis and monitoring. Biosensors and Bioelectronics 82(2016)140??145. |
466 | a-Synuclein Oligomers (T-SO508) | Protein | a-synuclein oligomers | 24 | 68 nM | TBS-T buffer for ELONA assay: 10 mM Tris-HCl, 150 mM NaCl, 5 mM KCl, pH 7.4 with 0.05% Tween 20. | 75.00% | 5' GCCTGTGGTGTTGGGGCGGGTGCG 3' | K Tsukakoshi. Selection of DNA aptamers that recognize a-synuclein oligomers using a competitive screening method. Anal Chem. 84(2012): 5542-5547 |
467 | Antibac1 | Peptide | Peptidoglycan | 55 | 415 µM | PBS 1x | 72.73% | 5' TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCATCGTCCTCCC 3' | Ferreira IM, de Souza Lacerda CM, de Faria LS, Corrêa CR, de Andrade AS. Selection of peptidoglycan-specific aptamers for bacterial cells identification. Appl Biochem Biotechnol. 2014 Dec;174(7):2548-56. doi: 10.1007/s12010-014-1206-6. Epub 2014 Sep 4. PMID: 25185503 |
468 | Adenosine/ATP (DH25.42) | Small Organic | Adenosine and ATP | 25 | 6 µM | Column Buffer: 300 mM NaC1, 5 mM MgC12, 20 mM Tris (pH 7.6) | 64.00% | 5' CCTGGGGGAGTATTGCGGAGGAAGG 3' | Huizenga and Szostak. "A DNA Aptamer That Binds Adenosine and ATP." Biochemistry, 34 (1995): 656-665. |
469 | PC12 Cells (Aptamer17a) | Cells | PC12 Cells | 25 | N/A nM | Washed with selection buffer (5 mM MgCl in PBS) from and 1 mg/ml yeast tRNAfor 30 minutes | 60.00% | 5' GGTTGGATGTAAGGTTGGAGGGGGG 3' | (A) Liu et al. "Dissection of the Functional Structure of Aptamer17, Which Specifically Recognizes Differential PC12 Cells." Nucleic Acid Therapeutics, 21(2011): 225-229. (B) Wang et al. "Single-stranded DNA Aptamers thatBbind Differentiated but not Parental Cells: Subtractive Systematic Evolution of Ligands by Exponential Enrichment." J. Biotechnol., 102(2003): 15-22 |
470 | V7t1 targeting VEGF-121 | Protein | VEGF-121 | 25 | 1.1 nM | 10% (v/v) human serum in TBSTE (TBSE containing 0.05% (v/v) of Tween-20). | 72.00% | 5' TGTGGGGGTGGACGGGCCGGGTAGA 3' | Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225. |