# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
351 Tetracycline (cb28 minimer) (ID# 116) Small Organic Tetracycline 60 ~1 µM Equilibration Buffer: 10 mM Tris–HCl (pH 7.6), 5 mM MgCl2, 250 mM NaCl 50.00% 5' GGCCUAAAACAUACCAGAUUUCGAUCUGGAGAGGUGAAGAAUUCGACCACCUAGGCCGGU 3' Berens C, Thain, A, Schroeder R. (2001) A tetracycline-binding RNA aptamer. Bioorg Med Chem. 9:2549-2556.
352 Hepatitis B Virus (HBV) Polymerase (P protein) (A9) (ID# 253) Protein Hepatitis B Virus (HBV) Polymerase (P protein) 61 NA binding buffer (0.1 M sodium phosphate (pH 7.4), 150 mM NaCl, 20 mM imidazol, 0.1% (v/v) NP-40, 100 mg/ml yeast tRNA), 30 °C 36.07% 5' UGGUUCAUGUCCUACUGUUCAAACAAAAAAACUGUGCACAAAAAUAAAUUGGGGCAUGGACA 3' Feng et al. "A SELEX-Screened Aptamer of Human Hepatitis B Virus RNA Encapsidation Signal Suppresses Viral Replication." PLoS One, 6(2011): e27862
353 ERK1/ ERK2 (Family II - Truncated) (ID# 481) Protein Extracellular Regulated Kinase 1 and 2 (ERK 1 and ERK2) 63 N/A nM  Buffer: 10 mM HEPES, pH 7.5; 10 mM MgCl2 42.86% 5' GGAAAGACGCUAGCGAAUUGGUUCCUCGAAAGGGGAAAGCGUUAUUAAGAAACCAAAAUUUCC 3' Seiwert, S., et al. "RNA aptamers as pathway-specific MAP kinase inhibitors." Chemistry & Biology, 7(2000): 833-834.
354 TLR3-ECD (Family-1) (ID# 211) Protein Toll-like receptor 3 Ectodomain 64 2.1 nM Binding buffer: 2 mM HEPES-NaOH (pH 7.6), 3 mM MgCl2, and 100 mM NaCl 60.94% 5' GGUAGAUACGAUGGAUACCCCCUGUGGCCCGUCAACACAGGGGAAGUGGCAUGACGCGCAGCCA 3' Watanabe et al. "Isolation of RNA aptamers against human Toll-like receptor 3 ectodomain." Nucleic Acids Symposium Series No. 50 (2006): 251-252.
355 Estrogen Aptamer (AptER-1) (ID# 517) Protein Apo-estrogen receptor alpha 65 16 nM 12 mM HEPES/pH 7.6, 150 mM NaCl, and 10 mM MgCl2 58.46% Xu, D., Chatakonda, V., Kourtidis, A., Conklin, D., and Shi, H. "In Search of Novel Drug Target Sites on Estrogen Receptors Using RNA Aptamers." Nucleic acid therapeutics 24.3 (2014): 227-38.
356 Hepatitis C NS3 Protein (10G-1) (ID# 130) Protein Hepatitis C NS3 Protein 66 990 pM  Binding Buffer: 50 mM Tris/HCl (pH 7.7), 30 mM NaCl, 5 mM CaCl2, 10 mM dithiothreitol and 1% BSA Elution Buffer (200 uL of 0.4 M sodium acetate, 5 mM EDTA, and 7 M urea (pH 5.5)) 56.06% 5' GGGAGAGCGGAAGCGUGCUGGGCCAGUAGUGUAUAGGGCUCGAAAUGUUCAUGGCUCAGUGGACAU 3' Urvil, P., et al. "Selection of RNA aptamers that bind specifically to the NS3 protease of hepatitis C virus." European Journal of Biochemistry, 248(1997):130-138.
357 Dopamine (dopa2/c.4) (ID# 401) Small Organic Dopamine 67 1.0 pM  Assay Buffer: 10 mM PBS, pH 7.2, 5mM MgCl2 62.69% 5' GGGAAUUCCGCGUGUGCGCCGCGGAAGAGGGAAUAUAGAGGCAGCACAUAGUGAGGCCCUCCUCCC 3' (A)Sequence from C Mannironi, et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-973. (B) Enzyme-linked assay from H Park and I R Paeng. "Development of direct competitive enzyme-linked aptamer assay for determination of dopamine in serum." Analytica Chimica Acta, 685 (2011): 65-73.
358 Clone 488 (ID# 560) Protein SelB 67 NA 50 mM potassium phosphate, pH 7.0, 5 mM Mg(OAc)2, 0.1 mM EDTA, 1 mM DTT, 0.5 mM GTP,0.02% Tween 20, 400 U/mL RNAsin 67.16% Klug, S. J. et al. "In vitro selection of RNA aptamers that bind special elongation factor SelB, a protein with multiple RNA-binding sites, reveals one major interaction domain at the carboxyl terminus." RNA, 1995 5: 1180 - 1190.
359 Bovine Thrombin (T7 05 RNA) (ID# 55) Protein Bovine Thrombin 68 164 nM SHMCK+ buffer (20 mM Hepes (pH 7.35), 120 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2 and 0.1% geletin) containing 0.05% Tween 20. Binding Buffer (SHMCK+ buffer containing 0.05% Tween 20) 44.12% 5' GCAAUGGUACGGUACUUCCUUUGGAAGAUAGCUGGAGAACUAACCAAAAGUGCACGCUACUUUGCUAA 3' (A) X Liu, et al. "RNA aptamers speci?c for bovine thrombin." Journal of Molecular Recognition, 16 (2003): 23-27. (B) X Liu, et al. "Screening of functional antidotes of RNA aptamers against bovine thrombin." FEBS Lett. 562(2004): 125-128
360 1G8-14 (ID# 580) Protein Ebola virus inhibitory domain (eVP35 IID) (EBOV) (eVP35) 70 3.7 nM  10mM HEPES (pH 7.0), 150mM NaCl, 2mM TCEP (tris(2-carboxyethyl)phosphine), 1mM MgCl2 60.00% Jennifer M. Binning, Tianjiao Wang, Priya Luthra, Reed S. Shabman, Dominika M. Borek, Gai Liu, Wei Xu, Daisy W. Leung, Christopher F. Basler, and Gaya K. Amarasinghe, ƒ??Development of RNA aptamers targeting ebolavirus VP35ƒ? Biochemistry 2013, 52, 8406-8419.