To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 531 | DTA-64 | Protein | DEK | 41 | N/A µM | Binding buffer (20 mM Tris pH 7.6; 100 mM NaCl; 5 mM MgCl2); Room Temperature (30 min - 1 hr, depending on round of testing). | 46.34% | 5' GGGGTTAAATATTCCCACATTGCCTGCGCCAGTACAAATAG 3' | N Mor-Vaknin et al. DEK-targeting DNA aptamers as therapeutics for inflammatory arthritis. Nature Communications 8(2017): 14252. |
| 532 | HMBA (aptabeacon) | Protein | 6X His-tag | 42 | ~4.2 nM | 1X DPBS without Ca and Mg (pH 7.1-7.5), 20 °C | 57.14% | 5' {5'/5-FAM}CAGGTTGGTCTGGTTGGGTTGGCTCCTGTGTACGCAACCTG 3' | X Tan et al. Molecular beacon aptamers for direct and universal quantitation of recombinant proteins from cell lysates. Anal. Chem. [published online ahead of print August 23, 2012]. doi: 10.1021/ac301764q |
| 533 | Cocaine Aptamer | Small Organic | Cocaine | 43 | N/A nM | The buffer for immobilization of ssDNA probe consisted of 0.8M phosphate buffer (PB) with 1.0M NaCl, 5 mM MgCl2 and 1 mM ethylenediamine tetraacetic acid (EDTA), pH 7.0. The DNA hybridization buffer and cocaine incubation buffer was composed of 50mM PB with 100mM K2SO4 (pH 7.4). | 41.86% | 5' GACAAGGATAAATCCTTCAATGAAGTGGGTCACTCATCTGTGA 3' | Yang, Z. et al. Community Sewage Sensors towards Evaluation of Drug Use Trends: Detection of Cocaine in Wastewater with DNA-Directed Immobilization Aptamer Sensors. Sci. Rep. 6, 21024; doi: 10.1038/srep21024 (2016). |
| 534 | GE54 | Protein | Rabies Virus glycoprotein(RABV) | 43 | 307 nM | 4.5g/L glucose, 5mM MgCl2, Dulbecco's PBS, yeast tRNA, 1.0g/L bovine serum albumin | 34.88% | Hong-Ru Liang, Gui-Qiu Hu, Xiang-Hong Xue, Lu Li, Xue-Xing Zheng,Yu-Wei Gao, Song-Tao Yang, Xian-Zhu Xia, "Selection of an aptamer against rabies virus: A new class of molecules with antiviral activity". Virus Research 184 (2014) 7-13. | |
| 535 | Human Neutrophil Elastase (DNA I) | Protein | Human Neutrophil Elastase (HNE) | 45 | 17 nM | Binding buffer: 150 mM NaCl, 100 mM Tris HCl (pH 7.0), 2 mM MgCl2, 6 mM KCl | 64.44% | 5' TAGCGATACTGCGTGGGTTGGGGCGGGTAGGGCCAGCAGTCTCGT 3' | Lin et al. "Peptide conjugation to an in vitro-selected DNA ligand improves enzyme inhibition." PNAS, 92(1995): 11044-11048. |
| 536 | Anti-IgE Aptamer, D 17.4 ext | Protein | IgE (human) | 45 | 3.6 nM | PBS containing 1 mM MgCl2 (pH 7.4) | 73.33% | 5' GCGCGGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCCGCGC 3' | (A) Aptamer Selection Reference: Wiegand, T.W., et al. "High-Affinity Oligonucleotide Ligands to Human IgE Inhibit Binding to FCE Receptor I." Journal of Immunology, 157 (1996): 221-230. (B) Liss, M., et al. "An Aptamer-Based Quartz Crystal Protein Biosensor." Anal. Chem.,74 (2002): 4488-4495 |
| 537 | Epithelial Cell Adhesion Molecule (EpCAM) SYL3C | Cells | Cancer Cells | 45 | 38 nM | 1 x PBS (pH-7.4) and 5 mM MgCl2 | 60.00% | 5' CACTACAGAGGTGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG 3' | Selection of DNA Aptamers against Epithelial Cell Adhesion Molecule for Cancer Cell Imaging and Circulating Tumor Cell Capture Yanling Song, Zhi Zhu, Yuan An, Weiting Zhang, Huimin Zhang, Dan Liu, Chundong Yu, Wei Duan, and Chaoyong James Yang Analytical Chemistry 2013 85 (8), 4141-4149 DOI: 10.1021/ac400366b |
| 538 | Internalin A of Listeria monocytogenes | Protein | Internalin A (InlA) | 47 | 103 CFU/mL | TBS: Tris 10 mM, NaCl 0.85%, pH 8.0 | 65.96% | 5' ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT 3' | S.H. Ohk et al. Antibody-aptamer functionalized fibre-optic biosensor for specific detection of Listeria monocytogenes from food. J. Appl. Microbiol. 109(2010): 808-817. |
| 539 | Ramos Cells (TD05) | Cells | Ramos Cells (B-cell lymphoma cell line) | 48 | 74.7 nM | Wash Buffer (4.5 g/L glucose and 5 mM MgCl2 in Dulbeccos PBS). Binding Buffer (yeast tRNA (0.1 mg/mL) and BSA (1 mg/mL) into the wash buffer). On ice. | 60.42% | 5' AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG 3' | Tang et al. "Selection of Aptamers for Molecular Recognition and Characterization of Cancer Cells." Analytical Chemistry, 79(2007): 4900-4907 |
| 540 | Histone (H4K16Ac) | Peptide | H4K16Ac | 48 | 47 nM | Washed with buffer A (150 mM NaCl, 5 mM Na2HPO4, 1 mM EDTA, pH 7.5) and PBS buffer (150 mM NaCl, 5 mM Na2HPO4. pH 7.5) three times. | 45.83% | 5' AGACGTAAGTTAATTGGACTTGGTCGTGTGCGGCACAGCGATTGAAAT 3' | Lin et al. "Recognition Imaging of Acetylated Chromatin Using a DNA Aptamer." Biophysical Journal, 97(2009): 1804-07. |