# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
531 DTA-64 Protein DEK 41 N/A µM Binding buffer (20 mM Tris pH 7.6; 100 mM NaCl; 5 mM MgCl2); Room Temperature (30 min - 1 hr, depending on round of testing). 46.34% 5' GGGGTTAAATATTCCCACATTGCCTGCGCCAGTACAAATAG 3' N Mor-Vaknin et al. DEK-targeting DNA aptamers as therapeutics for inflammatory arthritis. Nature Communications 8(2017): 14252.
532 HMBA (aptabeacon) Protein 6X His-tag 42 ~4.2 nM 1X DPBS without Ca and Mg (pH 7.1-7.5), 20 °C 57.14% 5' {5'/5-FAM}CAGGTTGGTCTGGTTGGGTTGGCTCCTGTGTACGCAACCTG 3' X Tan et al. Molecular beacon aptamers for direct and universal quantitation of recombinant proteins from cell lysates. Anal. Chem. [published online ahead of print August 23, 2012]. doi: 10.1021/ac301764q
533 Cocaine Aptamer Small Organic Cocaine 43 N/A nM The buffer for immobilization of ssDNA probe consisted of 0.8M phosphate buffer (PB) with 1.0M NaCl, 5 mM MgCl2 and 1 mM ethylenediamine tetraacetic acid (EDTA), pH 7.0. The DNA hybridization buffer and cocaine incubation buffer was composed of 50mM PB with 100mM K2SO4 (pH 7.4). 41.86% 5' GACAAGGATAAATCCTTCAATGAAGTGGGTCACTCATCTGTGA 3' Yang, Z. et al. Community Sewage Sensors towards Evaluation of Drug Use Trends: Detection of Cocaine in Wastewater with DNA-Directed Immobilization Aptamer Sensors. Sci. Rep. 6, 21024; doi: 10.1038/srep21024 (2016).
534 GE54 Protein Rabies Virus glycoprotein(RABV) 43 307 nM 4.5g/L glucose, 5mM MgCl2, Dulbecco's PBS, yeast tRNA, 1.0g/L bovine serum albumin 34.88% Hong-Ru Liang, Gui-Qiu Hu, Xiang-Hong Xue, Lu Li, Xue-Xing Zheng,Yu-Wei Gao, Song-Tao Yang, Xian-Zhu Xia, "Selection of an aptamer against rabies virus: A new class of molecules with antiviral activity". Virus Research 184 (2014) 7-13.
535 Human Neutrophil Elastase (DNA I) Protein Human Neutrophil Elastase (HNE) 45 17 nM Binding buffer: 150 mM NaCl, 100 mM Tris HCl (pH 7.0), 2 mM MgCl2, 6 mM KCl 64.44% 5' TAGCGATACTGCGTGGGTTGGGGCGGGTAGGGCCAGCAGTCTCGT 3' Lin et al. "Peptide conjugation to an in vitro-selected DNA ligand improves enzyme inhibition." PNAS, 92(1995): 11044-11048.
536 Anti-IgE Aptamer, D 17.4 ext Protein IgE (human) 45 3.6 nM PBS containing 1 mM MgCl2 (pH 7.4) 73.33% 5' GCGCGGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCCGCGC 3' (A) Aptamer Selection Reference: Wiegand, T.W., et al. "High-Affinity Oligonucleotide Ligands to Human IgE Inhibit Binding to FCE Receptor I." Journal of Immunology, 157 (1996): 221-230. (B) Liss, M., et al. "An Aptamer-Based Quartz Crystal Protein Biosensor." Anal. Chem.,74 (2002): 4488-4495
537 Epithelial Cell Adhesion Molecule (EpCAM) SYL3C Cells Cancer Cells 45 38 nM 1 x PBS (pH-7.4) and 5 mM MgCl2 60.00% 5' CACTACAGAGGTGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG 3' Selection of DNA Aptamers against Epithelial Cell Adhesion Molecule for Cancer Cell Imaging and Circulating Tumor Cell Capture Yanling Song, Zhi Zhu, Yuan An, Weiting Zhang, Huimin Zhang, Dan Liu, Chundong Yu, Wei Duan, and Chaoyong James Yang Analytical Chemistry 2013 85 (8), 4141-4149 DOI: 10.1021/ac400366b
538 Internalin A of Listeria monocytogenes Protein Internalin A (InlA) 47 103 CFU/mL TBS: Tris 10 mM, NaCl 0.85%, pH 8.0 65.96% 5' ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT 3' S.H. Ohk et al. Antibody-aptamer functionalized fibre-optic biosensor for specific detection of Listeria monocytogenes from food. J. Appl. Microbiol. 109(2010): 808-817.
539 Ramos Cells (TD05) Cells Ramos Cells (B-cell lymphoma cell line) 48 74.7 nM Wash Buffer (4.5 g/L glucose and 5 mM MgCl2 in Dulbecco’s PBS). Binding Buffer (yeast tRNA (0.1 mg/mL) and BSA (1 mg/mL) into the wash buffer). On ice. 60.42% 5' AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG 3' Tang et al. "Selection of Aptamers for Molecular Recognition and Characterization of Cancer Cells." Analytical Chemistry, 79(2007): 4900-4907
540 Histone (H4K16Ac) Peptide H4K16Ac 48 47 nM Washed with buffer A (150 mM NaCl, 5 mM Na2HPO4, 1 mM EDTA, pH 7.5) and PBS buffer (150 mM NaCl, 5 mM Na2HPO4. pH 7.5) three times. 45.83% 5' AGACGTAAGTTAATTGGACTTGGTCGTGTGCGGCACAGCGATTGAAAT 3' Lin et al. "Recognition Imaging of Acetylated Chromatin Using a DNA Aptamer." Biophysical Journal, 97(2009): 1804-07.