# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
471 V7t1 targeting VEGF-165 Protein VEGF-165 25 1.4 nM 10% (v/v) human serum in TBSTE (TBSE containing 0.05% (v/v) of Tween-20) 72.00% 5' TGTGGGGGTGGACGGGCCGGGTAGA 3' (A) Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225. (B) Stejskalov?­, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. Advanced Materials. 1806380. 10.1002/adma.201806380.
472 Tumor necrosis factor-alpha (TNFa) (VR11) Protein Tumor necrosis factor-alpha (TNFa) 26 7.0 nM Selection Buffer: PBS, 0.005% (v/v) Tween-20 64.00% 5' TGGTGGATGGCGCAGTCGGCGACAA 3' E Orava et al. A short DNA aptamer that recognizes TNFa and blocks its activity in vitro. ACS Chem. Biol. (2012) Accepted for print. DOI: 10.1021/cb3003557.
473 Anionic Porphyrins (ST1) Small Organic N-methylmesoporphyrin IX (NMM), mesoporphyrin IX (MPIX), and other metalloderivatives 25 0.7 µM SB Buffer: 100 mM Tris-acetate (pH 7.4), 200 mM sodium acetate, 25 mM potassium acetate, 10 mM magnesium acetate, 0.5% Triton X-100, and 5% dimethyl sulfoxide. 60.00% 5' AACGTGGGAGGGCGGTGGTGTTGAA 3' Y Li, CR Geyer, and D Sen. (1996) Recognition of anionic porphyrins by DNA aptamers. Biochem. 35:6911-6922.
474 S2.2 Protein MUC1 25 0.135 nM PBS buffer (pH 7.2); Room Temperature (overnight) 52.00% 5' GCAGTTGATCCTTTGGATACCCTGG 3' D Seleci et al. Aptamer mediated niosomal drug delivery. RSC Adv 6(2016): 87910-87918.
475 Nucleolin aptamer (AS1411) Protein Nucleolin 26 N/A nM For fluoresecent labeling, 400 nM aptamer were added to cell growth media for 1 hour at 37°C and 5% CO2. Dulbecco's phosphate-buffered saline was used to wash cells. 65.38% 5' GGTGGTGGTGGTTGTGGTGGTGGTGG 3' Kotula J, Sullenger B, et al. 2012. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells. Nucleic Acid and Therapeutics 22.3:187-195. Li, L. et al. 2014. Aptamer photoregulation in vivo. PNAS 11.48: 17099-103.
476 VEGF (SL2-B aptamer) Protein VEGF (165) 26 0.5 nM PBS and 0.005% tween-20 solution mixture was used as the running buffer, and 50 mM NaOH as the regeneration buffer. 61.54% 5' CAATTGGGCCCGTCCGTATGGTGGGT 3' Kaur H, Yung L-YL (2012) Probing High Affinity Sequences of DNA Aptamer against VEGF165. PLoS ONE 7(2): e31196. doi:10.1371/journal.pone.0031196
477 Anti-VEGF165 Protein Recombinant Human Vascular Endothelial Growth Factor 78 0.92 nM SPR Buffer A: 10 mM phosphate buffered saline; 138 mM NaCl; 2.7 mM KCL; pH 7.4 with 0.005% Tween 20. 61.54% A Potty et al. Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor. Biopolymers 91(2008):145-155.
478 StrepApt5 Protein Streptavidin 78 35 nM  NaCl (100 mM), MgCl2 (2 mM), KCl (5 mM), CaCl2 (1 mM), Tris-HCl (pH 7.6, 20 mM) 65.38% Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print.
479 Reactive Green 19 (GR-30) Small Organic Reactive Green 19 27 33 µM Column Buffer: 0.5 M LiCl, 20mM Tris-Cl (pH 7.6), 1 mM MgCl2 77.78% 5' GCAGGGGCGTTCGGGGGGTACCGCTGC 3' Ellington and Szostak. "Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures." Nature, 355 (1992): 850-852.
480 L-arginine (12-79)  Small Organic L-arginine 28 ~2.5 mM Buffer for CD binding assay: 10 mM sodium phosphate buffer (pH 7.5) and 100 mM NaCl. 62.96% 5' GACCAGGGCAAACGGTAGGGAGTGGTC 3' K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs. EMBO J, 14(23): 5798-5811.