To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
501 | Plasmodium vivax lactate dehydrogenase (pL1) | Protein | Plasmodium vivax lactate dehydrogenase (PvLDH) | 36 | 16.8 nM | Binding Buffer: 20mM Tris–HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl2) | 55.56% | 5' GTTCGATTGGATTGTGCCGGAAGTGCTGGCTCGAAC 3' | Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296. |
502 | Plasmodium falciparum lactate dehydrogenase (pL1) | Protein | Plasmodium falciparum lactate dehydrogenase (PfLDH) | 36 | 38.7 nM | Binding Buffer: 20mM Tris–HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl2) | 55.56% | 5' GTTCGATTGGATTGTGCCGGAAGTGCTGGCTCGAAC 3' | Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296. |
503 | Lysozyme Aptamer | Protein | Lysozyme | 36 | N/A µM | Borate buffer (pH 8.4); Room Temperature (30 min) | 36.11% | 5' TTTTTTATCAGGGCTAAAGAGTGCAGAGTTACTTAG 3' | J Zhao et al. High-Resolution and Universal Visualization of Latent Fingerprints Based on Aptamer-Functionalized Core-Shell Nanoparticles with Embedded SERS Reporters. ACS Appl. Mater. Interfaces 8(2016): 14389-14395. |
504 | Daunomycin (10.10) | Small Organic | Daunomycin | 37 | 272 nM | Binding Buffer (20 mM Tris-HCl (pH 7.4), 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 0.05% v/v Tween-20) | 56.76% | 5' ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTACGTCT 3' | Wochner et al. "A DNA aptamer with high affinity and specificity for therapeutic anthracyclines." Analytical Biochemistry, 373(2008): 34-42. |
505 | Plasmodium vivax lactate dehydrogenase (pL2) | Protein | Plasmodium vivax lactate dehydrogenase (PvLDH) | 38 | 31.7 nM | Binding Buffer: 20mM Tris–HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl2) | 57.89% | 5' GAACTCATTGGCTGGAGGCGGCAGTACCGCTTGAGTTC 3' | Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296. |
506 | Plasmodium falciparum lactate dehydrogenase (pL2) | Protein | Plasmodium falciparum lactate dehydrogenase (PfLDH) | 38 | 49.6 nM | Binding Buffer: 20mM Tris–HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl2) | 57.89% | 5' GAACTCATTGGCTGGAGGCGGCAGTACCGCTTGAGTTC 3' | Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296. |
507 | PCB77 (II) | Small Organic | 3,3,4,4-tetrachlorobiphenyl (PCB77) | 38 | 8.32 µM | Binding Buffer: 100 mM NaCl, 20 mM Tris–HCl [pH 7.6], 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween 20 | 55.26% | 5' AAGCGCGCGAGACTACGTTTGTAGGGATACCGATGTCG 3' | Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201. |
508 | Cocaine (MNS-4.1) | Small Organic | Cocaine | 38 | 0.4 µM | Phosphate buffer: 20 mM, pH7, 200 mM NaCl. | 47.37% | 5' GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCGACA 3' | M Stojanovic, P de Prada, and D Landry. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 123(2001): 4928-4931. |
509 | RNase H1 (VI-2) | Protein | RNase H1 | 39 | 11 nM | Buffer A (30 mM Tris–HCl (pH 8.5), 40 mM ammonium sulfate, 20 mM magnesium chloride, and 0.01% 2-mercaptoethanol) | 66.67% | 5' CGGTCGCTCCGTGTGGCTTGGGTTGGGTGTGGCAGTGAC 3' | Pileur, et al. "Selective inhibitory DNA aptamers of the human RNase H1." Nucleic Acids Research, 31 (2003): 5776-5788. |
510 | Apple Stem Pitting Virus of PSAH PearIsolate | Protein | Apple Stem Pitting Virus (ASPV) | 39 | 8.0 nM | Selection Buffer: PBS-T (10 mM Na2HPO4, 2 mM KH2PO4, 2.7 mM KCl, 137 mM NaCl, and 0.05%Triton-X; pH 7.5) with added 0.1 ?g/ml poly-dIdC and 1 ?g/ml BSA. | 46.15% | 5' AGCAAGGTTTGGTGTTGGTTGGTTGCTGGTTTTGGTTTC 3' | Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195. |