# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
491 Insulin Binding Aptamer (IBA) Protein Insulin 30 n/a nM 50 mM Tris-HCl, 10 mM KCl, 100 mM NaCl 66.67% 5' GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC 3' Pu, Y.; Zhu, Z.; Han, D.; Liu, H.; Liu, J.; Liao, J.; Zhang, K.; & Tan, W. Insulin-Binding Aptamer-Conjugated Graphene Oxide for Insulin Detection. Analyst, 2011, 136, 4138-4140
492 1.5 M Short Anti-Heparanase Aptamer Protein Heparanase 30 n/a nM Cell Culture Medium: 50% DMEM, 50% Ham’s F-12 Cell culture medium supplemented with: 50 mg/ml ascorbic acid, 250 ng/ml amphotericin B, 5mg/ml insulin (bovine pancreas), 0.4 ng/ml hydrocortisone and 10% heat-inactivated fetal bovine serum. 40.00% 5' ACTTTTGAATGTGGCAACAAATTCGACAGG 3' Simmons SC, Jamsa H, Silva D, Cortez CM, McKenzie EA, et al. (2014) Anti-Heparanase Aptamers as Potential Diagnostic and Therapeutic Agents for Oral Cancer. PLoS ONE 9(10): e96846. doi:10.1371/journal.pone.0096846
493 Thrombin (31mer) (D2-5) Protein Thrombin 31 N/A nM Buffer for Clotting Inhibition assay: Tris-HCl pH 8.0, 5 mM KCl, 100 mM NaCl. 61.29% 5' AGCGAGTAGGTTGGTGTGGTTGGGGCTCGCT 3' K Ikebukuro et al. Analysis of the evolution of the thrombin-inhibiting DNA aptamers using a genetic algorithm. Biotechnol Lett (2006) 28:1933ƒ??1937.
494 PSA aptamer (PSap4#5) Protein PSA 32 <100 nM 10 mM Tris/HCl, 150 mM NaCl, 5 mM KCl, 5 mM MgCl2, 0.05% Tween 20, pH 7.4, r.t. 28.13% 5' TTTTTAATTAAAGCTCGCCATCAAATAGCTTT 3' N Savory et al. Selection of DNA aptamer against prostate specific antigen using a genetic algorithm and application to sensing. Biosens. Bioelectron. 26 (2010): 1386-1391.
495 p-Nosyl Protected Alkyl Amino Group (M6b-M14) Small Organic p-nosyl protected alkyl amino groups 32 2.27 nM Optimized Buffer: 10 mM Na2HPO4, 2 mM KH2, 500 mM NaCl, pH 7.4. 50.00% 5' ATCATGGTGGGTATCGGCACTCGTTGGTTGAT 3' Mei H et al. (2012) Functional-group specific aptamers indirectly recognizing compounds with alkyl amino group. Anal. Chem. 84: 7323 - 7329
496 IR-A48 Protein Insulin Receptor 33 3.5 nM Krebs-Ringer HEPES Buffer. Tested in vivo. 70.37% 5' CGCCTGGNGNNAAGACAACCNCNAGGNCAGGCG 3' Yunn N, Koh A, Han S, Lim JH, Park S, et al. (2015) Agonistic Aptamer to the Insulin Receptor Leads to Biased Signaling and Functional Selectivity Through Allosteric Modulation. Nucleic Acids Research 1. doi:10.1093/narlgkv767
497 M64CA Protein MPT64 Protein 34 N/A nM SHCMK binding buffer: 20 mM HEPES, pH 7.35, 120 mM KCL, 1 mM CaCl2, and 1 mM MgCl2 35.29% 5' TTCGGGAATGATTATCAAATTTATGCCCTCTGAT 3' Qin, L., et al.(2009). "The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis." Clin Chem Lab Med, 47(4), 405-411. doi: 10.1515/CCLM.2009.097
498 Abrin Toxin (TA6) Protein Abrin Toxin 34 ~28 nM Selection Buffer (SHMCK; 20 mM HEPES (pH 7.35), 120 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2). 50.00% 5' ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT 3' Tang, J., et al. "In vitro selection of DNA aptamer against abrin toxin and aptamer-based abrin direct detection." Biosensors and Bioelectronics, 22 (2007): 2456-2463.
499 M64RA Protein MPT64 Protein 35 N/A nM SHCMK binding buffer: 20 mM HEPES, pH 7.35, 120 mM KCL, 1 mM CaCl2, and 1 mM MgCl2 48.57% 5' TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA 3' Qin, L., et al.(2009). "The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis." Clin Chem Lab Med, 47(4), 405-411. doi: 10.1515/CCLM.2009.097
500 Cd(II)-specific aptamer (CAP) Other Cadmium (II) 35 2.15 nM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid sodium salt (HEPES) buffer (pH 7.3). 42.86% 5' GGGGACTGTTGTGGTATTATTTTTGGTTGTGCAGT 3' Zhu, YF., Wang, YS., Zhou, B. et al. Anal Bioanal Chem (2017). doi:10.1007/s00216-017-0436-1.