# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
341 NADH�(ID#�280) Small Organic NADH 49 37 nM Selection Buffer (20 mM HEPES (pH 7.5), 300 mM KC1, and 5 mM MgC12) at room temperature. 59.18% 5' GGAACCCAACUAGGCGUUUGAGGGGAUUCGGCCACGGUAACAACCCCUC 3' Lauhon and Szostak. "RNA Aptamers That Bind Flavin and Nicotinamide Redox Cofactors." Journal of the American Chemical Society, 117(1994): 1246-1257.
342 NAD�(ID#�151) Small Organic NAD 49 2.5 nM Selection Buffer (20 mM HEPES (pH 7.5), 300 mM KC1, and 5 mM MgC12) at room temperature 59.18% 5' GGAACCCAACUAGGCGUUUGAGGGGAUUCGGCCACGGUAACAACCCCUC 3' Lauhon and Szostak. "RNA Aptamers That Bind Flavin and Nicotinamide Redox Cofactors." Journal of the American Chemical Society, 117(1994): 1246-1257.
343 Chloramphenicol (Cm1) Small Organic Chloramphenicol 50 110 nM� Binding Buffer (20 mM MgCl2, 400 mM NaCl, 100 mM bis-Tris (pH 6.4) 42.00% 5' GGGAUCACAGUGAAAAAAGACGUGUGAAUGUCACACUGAAAAAAGAUCCC 3' Burke et al. "RNA aptamers to the peptidyl transferase inhibitor chloramphenicol." Chemistry & Biology, 4(1997): 833-843.
344 Periostin Aptamer (PNDA-3) Protein Periostin 51 1.07 nM� 40 mM/1 HEPES, 102 mM/1 NaCl, 5 mM/1mol/1g Cl2,5 mM KCl 52.94% Lee, Y., Kim, I., Park, S., Kim, Y., Wu, S., Lee, J., Noh, D., Kim, K., Ryu, S. and Suh, P. "Periostin-binding DNA aptamer inhibits breast cancer growth and metastasis." The American Society of Gene & Cell Therapy 21.5 (2013): 1004-13.
345 A15�(ID#�564) Other Penetrating the Blood Brain Barrier� Not 54, 202 according to dB 10mM HEPES, pH 7.4, 50mM NaCl, 1mM MgCl2, 1mM CaCl2, 0.01% BSA 77.78% Congsheng Cheng, Yong Hong Chen, Kim A Lennox, Mark A Behlke, Beverly L Davidson, "In vivo SELEX for Identification of Brain-penetrating Aptamers" Molecular Therapy-Nucleic Acids (2013)2, e67, American Society of Gene & Cell Therapy
346 A14�(ID#�566) Other Penetrating the Blood Brain Barrier (BBB) 180 NA 10mM HEPES, pH 7.4, 50mM NaCl, 1mM MgCl2, 1mM CaCl2, 0.01% BSA 78.18% Congsheng Cheng, Yong Hong Chen, Kim A Lennox, Mark A Behlke, Beverly L Davidson, "In vivo SELEX for Identification of Brain-penetrating Aptamers" Molecular Therapy-Nucleic Acids (2013)2, e67, American Society of Gene & Cell Therapy
347 A09�(ID#�568) Other Penetrating the Blood Brain Barrier� 55 10mM HEPES, pH 7.4, 50mM NaCl, 1mM MgCl2, 1mM CaCl2, 0.01% BSA 78.18% Congsheng Cheng, Yong Hong Chen, Kim A Lennox, Mark A Behlke, Beverly L Davidson, "In vivo SELEX for Identification of Brain-penetrating Aptamers" Molecular Therapy-Nucleic Acids (2013)2, e67, American Society of Gene & Cell Therapy
348 Adenosine Triphosphate (1-1MIN) Small Organic Adenosine Triphosphate / ATP 57 4.8 �M 300 mM NaCl, 10 mM MgCl2�OR 30 mM MgCl2, 0.1 mM EDTA, and 25 mM Tris (pH 7.8) 54.39% 5' GGGAGAUCUACGGAUCUCAGGGCUCUUACGGGAGCUACAUGGAAGGAGUCCAUGUGU 3' P Sazani, R Larralde, and J Szostak.(2004) "A Small Aptamer with Strong and Specific Recognition of the Triphosphate of ATP." J Am Chem Soc.�126: 8370-8371.
349 Dopamine (dopa1.30/c.30)�(ID#�402) Small Organic Dopamine 58 NA Column Buffer: 50 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 0.5 M or 0.15 M NaCl 60.34% 5' GUCUCUGUGUGCGCCAGAGAACACUGGGGCAGAUAUGGGCCACACAGAAUGAGGCCC 3' Mannironi, C., et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-9734.
350 AMPA GluR2 (AN58)�(ID#�444) Protein AMPA GluR2 Glutamate Receptor Channel 58 419 pM 10% DMSO in Extracellular Buffer: 150 mM NaCl, 3 mM KCl, 1 mM CaCl2, 1 MgCl2, 10 HEPEs (pH 7.4)� 50.00% 5' GGGCGAAUUCAACUGCCAUCUAGGCAGUAACCAGGAGUUAGUAGGACAAGUUUCGUCC 3' Z. Huang et al. RNA aptamers selected against the GluR2 glutamate receptor channel.�Biochemistry�46(2007): 12648 - 12655.