# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
401 Nickel (N1) (ID# 93) Small Organic Nickel 89 800 nM  Ni-NTA resin (200 uL) equilibrated with a buffer (50 mM NaCl, 7 mM MgCl2, 50 mM Tris-HCl (pH 7.5) was heated at 75C for 3 min and then slowly cool to RT. The Sample was loaded on the Ni-NTA matrix for 5 min under gentle agitation. 44.94% 5' GGGAGAGGAUACUACACGUGGAAAAACCAACAAAUUGGGAAAAAUGUUAAGGGUCCACUUCAUGCCAUUGCAUGUAGCAGAAGCUUCCG 3' Hoffman, H., et al. "Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair." RNA Journal, 3 (1997): 1289-1300.
402 Interleukin 32 (IL-32) (AC3-3) Protein Interleukin-32 90 78 nM  Binding Buffer (20 mM sodium phosphate, 500 mM NaCl and 20 mM imidazole (pH 7.4)) 51.11% 5' GGGUUCACUGCAGACUUGACGAAGCUUCCGGAGAGAAGGGUCAAAGUUGUGCGGGAGUGUGUUGUGGAAUGGAUCCACAUCUACGAAUUC 3' Kim et al. "Generation of Antagonistic RNA Aptamers Specific to Proinflammatory Cytokine Interleukin-32." Bulletin of the Korean Chemical Society, 31 (2010): 3561-3566.
403 Cyclic Guanosine Monophosphate (AR2) Protein cGMP 90 N/A nM  Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2  55.56% 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCCUGCGAUGCAGAAAGGUGCUGACGACACAUCGAAACGGUAGCGAGAGCUC 3' Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001): 336-341.
404 Cyclic Adenosine Monophosphate (AR4) Small Organic cAMP 90 N/A nM Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2  54.44% 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUGUGGAAACAGACGUGGCACAUGACUACGUCGAAACGGUAGCGAGAGCUC 3' Seetharaman et al. "Immbolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341.
405 Cyclic Cytidine Monophosphate (AR3) Small Organic cCMP 90 N/A nM Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2  53.33% 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUUAGGGCCAAGUGUGGUGAAAGACACACUCGAAACGGUAGCGAGAGCUC 3' Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001):336-341.
406 H5 Avian Influenza Virus (HAS15-5) Protein Hemagglutinin of the Subtype H5 Avian Influenza Virus 90 N/A nM Wash Buffer (PBS Buffer (pH 7.4), 140 mM NaCl, and 2.7 mM KCl) 46.67% 5' GGGUUCACUGCAGACUUGACGAAGCUUACAAACAAGAGCAAAAAGGGAGUUGACGUAGACUGUGCGGAAUGGAUCCACAUCUACGAAUUC 3' Park et al. "Selection of an Antiviral RNA Aptamer Against Hemagglutinin of the Subtype H5 Avian Influenza Virus." Nucleic Acid Therapeutics, 21(2011): 395-402.
407 Salmonella Enteritidis (S25) Cells Salmonella Enteritidis 90 N/A nM Binding Buffer (0.5 M NaCl, 10 mM Tris-HCl, pH 7.5-7.6, and 1 mM MgCl2 with 0.1% Triton X 100) 50.00% 5' GGGUUCACUGCAGACUUGACGAAGCUUGAGAGAUGCCCCCUGAUGUGCAUUCUUGUUGUGUUGCGGCAAUGGAUCCACAUCUACGAAUUC 3' Hyeon, J. et al. Development of RNA Aptamers for Detection of Salmonellas Enteritidis. Journal of Microbiological Methods, 89(2012), 79-82.
408 1G8-14  Protein Ebola Virus VP35 90 3.7 nM  10 mM HEPES (pH 7.0), 150 mM NaCl, 2mM TCEP (tris(2-carboxyethyl)phosphine), and 1 mM MgCl2 and filtered through nitrocellulose membrane 46.67% Binning, J., Wang, T., Luthra, P., et al. (2013) Development of RNA aptamers targeting Ebola Virus VP35. Biochemistry, 52(47):8406-8419. doi: 10.1021/bi400704d
409 Adenine (12E4) Small Organic Adenine 91 10 nM Binding Buffer: 100 mM HEPES, 500 mM NaCl, 5 mM MgCl2 (pH 7.3) 47.25% 5' GGGAGAGGAUACUACACGUGAUAGGACGAUUAUCGAAAAUCACCAGAUUGGACCCUGGUUAACGAUCCAUUGCAUGUAGCAGAAGCUUCCG 3' Meli, M., et al. "Adenine-aptamer complexes: a bipartite RNA site that binds the adenine nucleic base." Journal of Biological Chemistry, 227 (2001): 2104-2111
410 Feline Immunodeficiency Virus (F1a) Protein Feline Immunodeficiency Virus (FIV) 91 1.9 nM Binding Buffer (50 mM Tris-HCl (pH 7.7), 200 mM potassium acetate, and 10 mM dithiothreitol) 51.65% 5' GGGAGGAUAUUUUCUCAGACCGUAAGUACCGAAUGUGCUUUUGGCCGAUUUUUGGCCCCUGCAGUUGCAGCAUCGUGAACUAGGAUCCGGG 3' Chen, et al. "Inhibitory RNA Ligand to Reverse Transcriptase from Feline Immunodeficiency Virus." Journal of Biochemistry, 35(1996): 6923-6930.