To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 401 | Nickel (N1) (ID# 93) | Small Organic | Nickel | 89 | 800 nM | Ni-NTA resin (200 uL) equilibrated with a buffer (50 mM NaCl, 7 mM MgCl2, 50 mM Tris-HCl (pH 7.5) was heated at 75C for 3 min and then slowly cool to RT. The Sample was loaded on the Ni-NTA matrix for 5 min under gentle agitation. | 44.94% | 5' GGGAGAGGAUACUACACGUGGAAAAACCAACAAAUUGGGAAAAAUGUUAAGGGUCCACUUCAUGCCAUUGCAUGUAGCAGAAGCUUCCG 3' | Hoffman, H., et al. "Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair." RNA Journal, 3 (1997): 1289-1300. |
| 402 | Interleukin 32 (IL-32) (AC3-3) | Protein | Interleukin-32 | 90 | 78 nM | Binding Buffer (20 mM sodium phosphate, 500 mM NaCl and 20 mM imidazole (pH 7.4)) | 51.11% | 5' GGGUUCACUGCAGACUUGACGAAGCUUCCGGAGAGAAGGGUCAAAGUUGUGCGGGAGUGUGUUGUGGAAUGGAUCCACAUCUACGAAUUC 3' | Kim et al. "Generation of Antagonistic RNA Aptamers Specific to Proinflammatory Cytokine Interleukin-32." Bulletin of the Korean Chemical Society, 31 (2010): 3561-3566. |
| 403 | Cyclic Guanosine Monophosphate (AR2) | Protein | cGMP | 90 | N/A nM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 55.56% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCCUGCGAUGCAGAAAGGUGCUGACGACACAUCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001): 336-341. |
| 404 | Cyclic Adenosine Monophosphate (AR4) | Small Organic | cAMP | 90 | N/A nM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 54.44% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUGUGGAAACAGACGUGGCACAUGACUACGUCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immbolized RNA switches for the analysis of complex chemical and biological mixtures." Nature Biotechnology, 19(2001): 336-341. |
| 405 | Cyclic Cytidine Monophosphate (AR3) | Small Organic | cCMP | 90 | N/A nM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 53.33% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGCCUUUAGGGCCAAGUGUGGUGAAAGACACACUCGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobolized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001):336-341. |
| 406 | H5 Avian Influenza Virus (HAS15-5) | Protein | Hemagglutinin of the Subtype H5 Avian Influenza Virus | 90 | N/A nM | Wash Buffer (PBS Buffer (pH 7.4), 140 mM NaCl, and 2.7 mM KCl) | 46.67% | 5' GGGUUCACUGCAGACUUGACGAAGCUUACAAACAAGAGCAAAAAGGGAGUUGACGUAGACUGUGCGGAAUGGAUCCACAUCUACGAAUUC 3' | Park et al. "Selection of an Antiviral RNA Aptamer Against Hemagglutinin of the Subtype H5 Avian Influenza Virus." Nucleic Acid Therapeutics, 21(2011): 395-402. |
| 407 | Salmonella Enteritidis (S25) | Cells | Salmonella Enteritidis | 90 | N/A nM | Binding Buffer (0.5 M NaCl, 10 mM Tris-HCl, pH 7.5-7.6, and 1 mM MgCl2 with 0.1% Triton X 100) | 50.00% | 5' GGGUUCACUGCAGACUUGACGAAGCUUGAGAGAUGCCCCCUGAUGUGCAUUCUUGUUGUGUUGCGGCAAUGGAUCCACAUCUACGAAUUC 3' | Hyeon, J. et al. Development of RNA Aptamers for Detection of Salmonellas Enteritidis. Journal of Microbiological Methods, 89(2012), 79-82. |
| 408 | 1G8-14 | Protein | Ebola Virus VP35 | 90 | 3.7 nM | 10 mM HEPES (pH 7.0), 150 mM NaCl, 2mM TCEP (tris(2-carboxyethyl)phosphine), and 1 mM MgCl2 and filtered through nitrocellulose membrane | 46.67% | Binning, J., Wang, T., Luthra, P., et al. (2013) Development of RNA aptamers targeting Ebola Virus VP35. Biochemistry, 52(47):8406-8419. doi: 10.1021/bi400704d | |
| 409 | Adenine (12E4) | Small Organic | Adenine | 91 | 10 nM | Binding Buffer: 100 mM HEPES, 500 mM NaCl, 5 mM MgCl2 (pH 7.3) | 47.25% | 5' GGGAGAGGAUACUACACGUGAUAGGACGAUUAUCGAAAAUCACCAGAUUGGACCCUGGUUAACGAUCCAUUGCAUGUAGCAGAAGCUUCCG 3' | Meli, M., et al. "Adenine-aptamer complexes: a bipartite RNA site that binds the adenine nucleic base." Journal of Biological Chemistry, 227 (2001): 2104-2111 |
| 410 | Feline Immunodeficiency Virus (F1a) | Protein | Feline Immunodeficiency Virus (FIV) | 91 | 1.9 nM | Binding Buffer (50 mM Tris-HCl (pH 7.7), 200 mM potassium acetate, and 10 mM dithiothreitol) | 51.65% | 5' GGGAGGAUAUUUUCUCAGACCGUAAGUACCGAAUGUGCUUUUGGCCGAUUUUUGGCCCCUGCAGUUGCAGCAUCGUGAACUAGGAUCCGGG 3' | Chen, et al. "Inhibitory RNA Ligand to Reverse Transcriptase from Feline Immunodeficiency Virus." Journal of Biochemistry, 35(1996): 6923-6930. |