# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
301 CL4 nucleic acid EGFR 39 10 nM phosphate-buffered saline (PBS) supplemented with 0.01% bovine serum albumin 71.43 5?-GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3? https://patents.google.com/patent/US9125930B2/en?oq=US+9125930
302 EpCAM aptamer transferrin receptor 64 8.997±1.679 PBS with 10% FCS, 1 mg/ml_ BSA, 0.1 mg/ml_ tRNA). Cells (50??_ 51.56 5’-GAATTCCGCGTGTGCACACGCTCACAGTTAGTATCGCTACGTTCTTTGGTAGTCCGTTCG GGAT-3’ https://patents.google.com/patent/WO2016127216A1/en?oq=WO+2016127216
303 Bifidobacterium breve bifidobacterium breve 80 11.47±0.99 50mmol / L Tris-HCl (pH 7.4), 5mmol / L KC1, lOOmmol / L NaCl, lmmol / L MgCl2 60 5'-AGCAGCACAGAGGTCAGATGCCGGGCAGCGGTCAATGCCGCAC CTTCCATATGATCGGGGCCTATGCGTGCTACCGTGAA-3' https://patents.google.com/patent/CN105838719A/en?oq=CN+105838719
304 L-?serine aptamer L-?serine 45 33.24±7.73 D-Hank's solution was added to 0.5mM MgC12 46.67 5'-ACGCATTTGTGTCGTTGGCGTATTGCCGTAAACGTACTAGCTGTA-3' https://patents.google.com/patent/CN105821046A/en?oq=CN+105821046
305 glioma stem cells aptamers glioma stem cell (GSC)? 80 4.9±1.4 1xPBS, 4.5g/L glucose, 0.5mmol/LMgCl2, 0.1g/LtRNA, 1g/LBSA 47.5 5'-TTGACTTGCCACTGACTACCCCAGTATCTCTTCAACGCTATGGTGCATGTACTACGTATTGAAGTCAGTCG GTCGTCATC-3' https://patents.google.com/patent/CN105821043A/en?oq=CN+105821043
306 RA16 non-small cell lung cancer 100yL DEPC-H20, was added an equal volume of 0.2M NaHC03 solution, then add an appropriate amount of NHS-PEG (30kD) powder, rt for 2h, a final concentration of 20mM Tri s-HCl buffer and unreacted NHS, PEG-modified to give the RA16 68.18 5 '-GGGAGAGAACAAUGACCUGCGGUGCCAAGCCGUCGGGUUAUGUUGAUCUCCACAAGGACGAGUGC AUUGCAUCACGUCAGUAG-3' https://patents.google.com/patent/CN105779458A/en?oq=CN+105779458
307 STRG2 Protein MUC1-5TR-GalNAc; Tn antigen 70 18.6 nM 150 nM NaCl, 5nM MgCl2, pH 7.4 5'-dGpdApdGpdApdCpdApdApdGpdApdApdTpdApdApdApdCpdGpdCpdTpdCpdApdApdGpdGpdCpdTpdApdTpdApdGpdCpdApdCpdApdTpdGpdGpdGpdTpdApdApdApdApdCpdGpdApdCpdTpdTpdCpdGpdApdCpdApdGpdGpdApdGpdGpdCpdTpdCpdApdCpdApdApdCpdApdGpdGpdCp-3' Ferreira, C.S.; Cheung, M.C.; Missailidis, S.; Bisland, S.; Gariepy, J. Phototoxic aptamers selectively enter and kill epithelial cancer cells. Nucleic acids research 2009, 37, 866-876.
308 Mycolactone Aptamer Protein mycolactone 0 6.3 µM 1X concentration (1X PBS [pH 7.4] and 10 mMMgCl2) Sakyi, Samuel A., et al. "RNA Aptamer That Specifically Binds to Mycolactone and Serves as a Diagnostic Tool for Diagnosis of Buruli Ulcer." 
309 Epithelial cell adhesion molecule(EpCAM) Protein Cancer stem cell marker epithelial cell adhesion molecule 19 12 nM Assay Buffer: DPBS with 5 mM MgCl2, 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 02% [w/v] sodium azide, and 5% FCS 68.42% S Shigdar et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule
310 Interleukin-6 receptor Cells Cells presenting IL-6R 19 8.5 nM 137 mM NaCl, 2.7 mM KCl, 6.5 mM Na2HPO4, and 3 mM MgCl2 at PH 7.5. 73.68% 5' GGGGAGGCUGUGGUGAGGG 3' Meyer C, U Hahn, et al. (2012) Interleukin-6 Receptor specific RNA aptamers for cargo delivery into target cells. RNA Biol