# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
311 Ricin A-chain (RTA) Aptamer Protein Ricin A-chain (RTA) 26 7.4 nM 1X PBS, 5 mM MgCl2 69.23% 5' GGCGAACAGGGGACGAGCAAGACGCC 3' (A) (1) Bogomolova, A., Aldissi, M. ƒ??Real-time and label-free analyte detection in a flow-through mode using immobilized fluorescent aptamer/quantum dots molecular switches.ƒ? Biosensors and Bioelecgtronics, 66 (2015): 290-296 (B) Hesselberth, J., et al. “In vitro Selection of RNA Molecules That Inhibit the Activity of Ricin A-chain.” 
312 GRK2 Protein G protein-coupled receptor kinase 2 28 1.2 nM 20 mM Tris (pH 7.0), 50 mM NaCl, 5 mM MgCl2,2 mM DTT, and 0.1% Lubrol 57.14% 5' GGCAGACCAUACGGGAGAGAAACUUGCC 3' Tesmer et al., Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer, Structure (2012)
313 1-PA  Protein Anthrax Protective Antigen (PA 29 8.53 nM 50 uL Human Serum, 5 mM HEPES 48.28% Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties. Analyst, 2011
314 cAMP  Small Organic cAMP 31 10 µM 20 mM Tris-HCl (pH 7.5 at 23 °C), 450 mM NaCl, 100 mM KCl, 10 mM MgCl2, 1 mM MnCl2, and 5 mM CaCl2 51.61% 5' GGAAGAGAUGGCGACUAAAACGACUUGUCGC 3' Kozumi and Breaker. "Molecular Recognition of cAMP by an RNA Aptamer." Biochemistry, 39 (2000)
315 Xanthine Small Organic Xanthine 32 3.3 nM 20 mM Tris–HCl (pH 7.5), 0.3 M NaCl and 5 mM MgCl2 59.38% 5' GGCACGUGUAUUACCCUAGUGGUCGACGUGCC 3' Kiga, D., et al. "An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition." Nucleic Acids Research, 26 (1998)
316 L-Isoleucine Small Organic L-Isoleucine 32 200 nM Selection Buffer (10 mM HEPES (pH 7.0), 300 mM NaCl, and 7.5 mM MgCl2 (buffer B) and 0.1 mM each of ZnCl2, CaCl2, and MnCl2 and 0.01 mM CuCl) Reaction Buffer (50 mM sodium borate (pH 8.0), 42 mM KCl, 7.5 mM MgCl2, and 0.4 mM ZnCl2) 56.25% 5' GGUCUUACGUCGUUCGCGACUAUUGGGAGACC 3' Majerfeld and Yarus. "Isoleucine:RNA sites with associated coding sequence." RNA, 4 (1998): 471-478.
317 Moloney Murine Leukemia Virus Protein Moloney Murine Leukemia Virus  33 6.9 nM 50 mM Tris-HC1 (pH 7.7), 200 mM potassium acetate, and 10 mM DTT 57.58% 5' UUACCACGCGCUCUUAACUGCUAGCGCCAUGGC 3' Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994)
318 Basic Fibroblast Growth Factor  Protein Basic Fibroblast Growth Factor  34 190 pM  Selection Buffer (1X PBS = 10.1 mM Na2HPO4/1.8 mMKH2PO4/137 mM NaCl/2.7 mM KCl, pH 7.4) 52.94% 5' GGUGAAGGCAACGUAUAGGCAAGCACACUUCACC 3' Jellinek, D., et al. "High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding." Proceedings of the National Academy of Sciences of the United States of America, 90(1993):
319 GL21.T Protein Axl tyrosine kinase receptor 34 12 nM Dulbecco's Modified Eagle's Medium (DMEM), 10% FBS, 2mM L-glutamine 50.00% 5' AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC 3' Laura Cerchia, Carla L Esposito, Simona Camorani, Anna Rienzo, Loredana Stasio, Luigi Insabato, Andrea Affuso and Vittorio de Franciscis,"Targeting Axl With an High-affinity Inhibitory Aptamer". Molecular Therapy vol.20 no.12, 2291-2303, Dec2012.
320 SP6 RNA polymerase Protein SP6 RNA Polymerase 35 9.5 nM Binding Buffer (50mM Tris-HCl, pH 7.6, 1 M NaCl, 10mM 2-mercaptoethanol, 10% glycerol) at 4°C overnight at -20°C until use 40.00% 5' UUGCUUGGAAUGCGUUAUAGUCUCUUAGGUGUGUA 3' Mori, Y. (2012). Inhibitory RNA aptamer against sp6 RNA polymerase. Biochemical and Biophysical Resarch Communications, 420 (2012), 440-443.