# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
511 Z23 Anti-Vesicular Stomatitis Virus Other Vesicular Stomatitis Virus 39 EC50 =/< 80 nM 90% High Glucose DMEM, 10% Fetal Bovine Serum. Tested in vivo 48.72% 5' GGGACCTATCAGGCGATGTGAAAACTCTTATACCACTGG 3' Muharemagic D, Zamay A, Ghobadloo SM, Evgin L, Savitskaya A, et al. (2014) Aptamer-Facilitated Protection of Oncolytic Virus from Neutralizing Antibodies. Molecular Therapy--Nucleic Acids 3, e167. doi: 10.1038/mtna.2014.19
512 Platelet-Derived Growth Factor (PDGF) B-chain (36t) Protein Platelet-Derived Growth Factor -AB (PDGF-AB) 40 0.094 nM Selection Buffer: PBSM(10.1 mM Na2HPO4, 1.8 mM K2HPO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2�(pH 7.4)) 56.41% 5' CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT 3' Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424.
513 MT32 protein of Apple Stem Pitting Virus (ASPV) Protein MT32 coat protein 40 55 nM Selection Buffer: PBS-T (10 mM Na2HPO4, 2 mM KH2PO4, 2.7 mM KCl, 137 mM NaCl, and 0.05%Triton-X; pH 7.5) with added 0.1 ?g/ml poly-dIdC and 1 ?g/ml BSA. 57.50% 5' GGGGTGGTGGGTTCTTTTTGTGGTATTGGTGTGGGGGGCA 3' Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195.
514 Anti-His Tag (6H7) Protein 6X His Tag 40 4.6 nM Selection Buffer (50mM K2HPO4, 150mM NaCl, 0.05% Tween 20 (pH 7.5)) 67.50% 5' GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC 3' Kokpinar, et al. "Aptamer-Based Downstream Processing of His-Tagged Proteins Utilizing Magnetic Beads." Biotechnology and Bioengineering, 108(2011):2371-2379.
515 Phospholamban (Apt-9) Protein Phospholamban 40 20 nM 10 mL of PBS (0..5% Tween 20) containing bead-bound PDZ-Myc-His6�(5 uL) and 1 ug/mL BSA was incubated for 30 minutes with library. 55.00% 5' TTGGGGAGGGGCACTGGGCAGTGTAATTTACGAAAGCGAG 3' Tanaka�et al. "In Vitro�Selection and Characterization of DNA Aptamers Specific for Phospholamban."�The Journal of Pharmacology and Experimental Therapeutics,�329(2009): 57-63.
516 PCB77 (VIII) Small Organic 3,3,4,4-tetrachlorobiphenyl (PCB77) 40 4.02 �M Binding Buffer: 100 mM NaCl, 20 mM Tris�HCl [pH 7.6], 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween 20 57.50% 5' GGCGGGGCTACGAAGTAGTGATTTTTTCCGATGGCCCGTG 3' Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201.
517 a-Bungarotoxin (Clone 24) Protein a-Bungarotoxin 40 7.5 �M PBS binding buffer for SPR: 137 mM NaCl, 2.7 mM KCl, 4.2 mM Na2HPO4, and 0.005% Tween 20. 55.00% 5' GCGAGGTGTTCGAGAGTTAGGGGCGACATGACCAAACGTT 3' L H Lauridsen. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against a-bungarotoxin.�PLoS ONE�7(2012): e41702.
518 Platelet-Derived Growth Factor (PDGF) B-chain (36t) Protein Platelet-Derived Growth Factor -BB (PDGF-BB) 40 0.093 nM Selection Buffer: PBSM(10.1 mM Na2HPO4, 1.8 mM K2HPO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2�(pH 7.4)) 56.41% 5' CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT 3' (a)Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424. (b) Stejskalov?�, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. Advanced Materials. 1806380. 10.1002/adma.201806380.
519 Antigen binding fragment of antivesicular stomatitis virus polyclonal antibodies (C5S) Protein Antigen binding fragment (Fab) of antivesicular stomatitis virus (VSV) rabbit polyclonal antibodies 40 N/A nM DPBS 67.50% 5' TGTGCCAAAGAGAGTGGTGGGGGGGTGGGCGGAACTCGCG 3' D Maharemagic et al. Anti-Fab aptamers for shielding virus from neutralizing antibodies.�JACS�134(2012): 17168-17177.
520 Swine Influenza A Virus - H3N2 (HA68)� Protein Recombinant H3 cluster IV 40 7.1 nM For Selection: 50 mM NaH2PO4, 50 mM NaCl, and 20 mM imidazole (pH 8.0) for 1 hour on a rotisserie shaker For Binding Affinity: 1% fish gelatin, gentle shaking for 1 hour 50.00% 5' ACTCCGTCATCTTTAGTGGCCCCAATGTCGTTATCACCGA 3' Wongphatcharachai, Manoosak, et al. "Neutralizing DNA Aptamers against Swine Influenza H3N2 Viruses." Journal of Clinical Microbiology 2013, 51(1):46.