To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 511 | Z23 Anti-Vesicular Stomatitis Virus | Other | Vesicular Stomatitis Virus | 39 | EC50 =/< 80 nM | 90% High Glucose DMEM, 10% Fetal Bovine Serum. Tested in vivo | 48.72% | 5' GGGACCTATCAGGCGATGTGAAAACTCTTATACCACTGG 3' | Muharemagic D, Zamay A, Ghobadloo SM, Evgin L, Savitskaya A, et al. (2014) Aptamer-Facilitated Protection of Oncolytic Virus from Neutralizing Antibodies. Molecular Therapy--Nucleic Acids 3, e167. doi: 10.1038/mtna.2014.19 |
| 512 | Platelet-Derived Growth Factor (PDGF) B-chain (36t) | Protein | Platelet-Derived Growth Factor -AB (PDGF-AB) | 40 | 0.094 nM | Selection Buffer: PBSM(10.1 mM Na2HPO4, 1.8 mM K2HPO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2 (pH 7.4)) | 56.41% | 5' CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT 3' | Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424. |
| 513 | MT32 protein of Apple Stem Pitting Virus (ASPV) | Protein | MT32 coat protein | 40 | 55 nM | Selection Buffer: PBS-T (10 mM Na2HPO4, 2 mM KH2PO4, 2.7 mM KCl, 137 mM NaCl, and 0.05%Triton-X; pH 7.5) with added 0.1 ?g/ml poly-dIdC and 1 ?g/ml BSA. | 57.50% | 5' GGGGTGGTGGGTTCTTTTTGTGGTATTGGTGTGGGGGGCA 3' | Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195. |
| 514 | Anti-His Tag (6H7) | Protein | 6X His Tag | 40 | 4.6 nM | Selection Buffer (50mM K2HPO4, 150mM NaCl, 0.05% Tween 20 (pH 7.5)) | 67.50% | 5' GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC 3' | Kokpinar, et al. "Aptamer-Based Downstream Processing of His-Tagged Proteins Utilizing Magnetic Beads." Biotechnology and Bioengineering, 108(2011):2371-2379. |
| 515 | Phospholamban (Apt-9) | Protein | Phospholamban | 40 | 20 nM | 10 mL of PBS (0..5% Tween 20) containing bead-bound PDZ-Myc-His6 (5 uL) and 1 ug/mL BSA was incubated for 30 minutes with library. | 55.00% | 5' TTGGGGAGGGGCACTGGGCAGTGTAATTTACGAAAGCGAG 3' | Tanaka et al. "In Vitro Selection and Characterization of DNA Aptamers Specific for Phospholamban." The Journal of Pharmacology and Experimental Therapeutics, 329(2009): 57-63. |
| 516 | PCB77 (VIII) | Small Organic | 3,3,4,4-tetrachlorobiphenyl (PCB77) | 40 | 4.02 µM | Binding Buffer: 100 mM NaCl, 20 mM Tris–HCl [pH 7.6], 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween 20 | 57.50% | 5' GGCGGGGCTACGAAGTAGTGATTTTTTCCGATGGCCCGTG 3' | Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201. |
| 517 | a-Bungarotoxin (Clone 24) | Protein | a-Bungarotoxin | 40 | 7.5 µM | PBS binding buffer for SPR: 137 mM NaCl, 2.7 mM KCl, 4.2 mM Na2HPO4, and 0.005% Tween 20. | 55.00% | 5' GCGAGGTGTTCGAGAGTTAGGGGCGACATGACCAAACGTT 3' | L H Lauridsen. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against a-bungarotoxin. PLoS ONE 7(2012): e41702. |
| 518 | Platelet-Derived Growth Factor (PDGF) B-chain (36t) | Protein | Platelet-Derived Growth Factor -BB (PDGF-BB) | 40 | 0.093 nM | Selection Buffer: PBSM(10.1 mM Na2HPO4, 1.8 mM K2HPO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2 (pH 7.4)) | 56.41% | 5' CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT 3' | (a)Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424. (b) Stejskalov?, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. Advanced Materials. 1806380. 10.1002/adma.201806380. |
| 519 | Antigen binding fragment of antivesicular stomatitis virus polyclonal antibodies (C5S) | Protein | Antigen binding fragment (Fab) of antivesicular stomatitis virus (VSV) rabbit polyclonal antibodies | 40 | N/A nM | DPBS | 67.50% | 5' TGTGCCAAAGAGAGTGGTGGGGGGGTGGGCGGAACTCGCG 3' | D Maharemagic et al. Anti-Fab aptamers for shielding virus from neutralizing antibodies. JACS 134(2012): 17168-17177. |
| 520 | Swine Influenza A Virus - H3N2 (HA68) | Protein | Recombinant H3 cluster IV | 40 | 7.1 nM | For Selection: 50 mM NaH2PO4, 50 mM NaCl, and 20 mM imidazole (pH 8.0) for 1 hour on a rotisserie shaker For Binding Affinity: 1% fish gelatin, gentle shaking for 1 hour | 50.00% | 5' ACTCCGTCATCTTTAGTGGCCCCAATGTCGTTATCACCGA 3' | Wongphatcharachai, Manoosak, et al. "Neutralizing DNA Aptamers against Swine Influenza H3N2 Viruses." Journal of Clinical Microbiology 2013, 51(1):46. |