To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
331 | Pepocin (9-41U22) | Protein | Pepocin | 41 | 18 nM� | Binding buffer: 3 mM NaH2PO4, 3 mM MgCl2, 45 mM NaCl, 2.5 mM EDTA, 3 mM Tris-HCl (pH 7.5), 0.15 mM DTT, and 12% glycerol. | 43.90% | 5' GGGAGUCUGAAGUCGGACUUGUUAUCAAUUCACUUCAGACU 3' | Hirao�et al. "RNA Aptamers That Bind to and Inhibit the Ribosome-inactivating Protein, Pepocin."�The Journal of Biological Chemistry,�275(2000) |
332 | S-adenosyl homocysteine (CTH-5) | Small Organic | S-adenosyl homocysteine | 42 | 0.1 nM | RNA Buffer (300 mM NaCl, 25 mM Tris (pH 7.6), 5 mM MgCl2) HBS Buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3.4 mM EDTA, and 0.005% P-20) Carbonate Buffer (0.05 M NaHCO3 0.125 M NaCl (pH 8.3)) | 64.29% | 5' GGGCGGAUGAGACGCUUGGCGUGUGCUGUGGAGAGUCAUCCG 3' | Gebhardt, K., et al. "RNA Aptamers to S-Adenosylhomocysteine: Kinetic Properties, Divalent Cation Dependency, and Comparison with Anti-S-adenosylhomocysteine Antibody." Biochemistry, 39 (2000) |
333 | Mouse Lipocalin-2 (mLcn2) (Oligo 569)� | Protein | Mouse Lipocalin-2 (mLcn2) | 42 | 340 nM� | Selection Buffer: 50 mM KH2PO4, 150 mM NaCl, 5 mM MgCl2, pH 7.4. | 54.76% | 5' CCUCCGGCUCAUACCUUUUCGAAGACAAGCUUCGACAGGAGG 3' | L. Zhat et al. An RNA aptamer-based microcantilever sensor to detect the inflammatory marker, mouse lipocalin-2.�Anal. Chem.�84(2012) |
334 | Salmonella Typhimurium OmpC Protein (T-2) | Protein | S. Typhimurium OmpC Protein | 42 | 20 nM� | SELEX binding buffer (30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 2 mM dithiothreitol, and 1% BSA) | 54.76% | Han, S. R. and Lee, S. "In Vitro Selection of RNA Aptamer Specific to Salmonella Typhimurium." Journal of Microbiology and Biotechnology, 23.6(2013) | |
335 | Avian Myeloblastosis Virus (a.1.1) | Protein | Avian Myeloblastosis Virus (AMV)� | 43 | 0.5 nM� | Binding Buffer (50 mM Tris-HC1 (pH 7.7), 200 mM potassium acetate, and 10 mM DTT) | 55.81% | 5' CGUCCCGUGCGCAAAAGUUCUUAGCGCUAGCAGUCCUAGUUGC 3' | Chen and Gold. "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994) |
336 | L-Citrulline (44Cit11) | Small Organic | L-Citrulline | 44 | 68 nM� | Binding Buffer (250 mM NaCl, 50 mM Tris-HCl (pH=8.3), 5 mM MgCl2) | 52.27% | 5' GACGAGAAGGAGUGCUGGUUAUACUAGCGGUUAGGUCACUCGUC 3' | Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706. |
337 | C-Reactive Protein Monomer�(ID#�164) | Protein | Monomeric C-Reactive Protein (CRP) | 44 | 187.7 nM� | Binding Buffer: 20 mM HEPES, 140 mM NaCl, 50 mM KCl, 0.1 mM DTT, and 5% glycerol at pH 6.5� | 56.82% | 5' GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC 3' | (A) M S Wang et al. "C-reactive protein (CRP) aptamer binds to monomeric but not pentameric form of CRP." Analytical and Bioanalytical Chemistry, 401(2011): 1309-1318. (B) M S Wang and S M Reed. Direct visualization of electrophoretic mobility shift assays using nanoparticle-aptamer conjugates. Electrophoresis. 33(2012): 348-351. |
338 | L-Arginine(44Arg11) | Small Organic | L-Arginine | 44 | 60 nM | Binding Buffer (250 mM NaCl, 50 mM Tris-HCl (pH=8.3), 5 mM MgCl2) | 56.82% | 5' GACGAGAAGGAGCGCUGGUUCUACUAGCAGGUAGGUCACUCGUC 3' | Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706 |
339 | Thyroxine (ApT4-A') | Small Organic | Thyroxine | 44 | 50 �M | Loading buffer: 10mM Tris-HCl (pH 7.5), 500 mM NaCl, and 1 mM MgCl2 | 65.91% | 5' GGUGGAGGGGGACGUGCUGCAUCCGCAGUGCGUCUUGGGUUGUG 3' | Levesque�et al. "In vitro�selection and characterization of RNA aptamers binding thyroxine hormone."�Biochemical Journal,�403(2007): 129-138. |
340 | C-Reactive Protein�(ID#�454) | Protein | C-Reactive Protein (CRP) | 44 | 125 nM | SPR Binding Buffer: HEPES at pH 6.5 with 0.005% Tween 20 | 56.82% | 5' GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC 3' | A Bini, M Mascini, et al. Development of an optical RNA-based aptasensor for C-reactive protein.�Anal. Bioanal. Chem.�390(2008): 1077-1088 |