# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
331 Pepocin (9-41U22) Protein Pepocin 41 18 nM  Binding buffer: 3 mM NaH2PO4, 3 mM MgCl2, 45 mM NaCl, 2.5 mM EDTA, 3 mM Tris-HCl (pH 7.5), 0.15 mM DTT, and 12% glycerol. 43.90% 5' GGGAGUCUGAAGUCGGACUUGUUAUCAAUUCACUUCAGACU 3' Hirao et al. "RNA Aptamers That Bind to and Inhibit the Ribosome-inactivating Protein, Pepocin." The Journal of Biological Chemistry, 275(2000)
332 S-adenosyl homocysteine (CTH-5) Small Organic S-adenosyl homocysteine 42 0.1 nM RNA Buffer (300 mM NaCl, 25 mM Tris (pH 7.6), 5 mM MgCl2) HBS Buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3.4 mM EDTA, and 0.005% P-20) Carbonate Buffer (0.05 M NaHCO3 0.125 M NaCl (pH 8.3)) 64.29% 5' GGGCGGAUGAGACGCUUGGCGUGUGCUGUGGAGAGUCAUCCG 3' Gebhardt, K., et al. "RNA Aptamers to S-Adenosylhomocysteine: Kinetic Properties, Divalent Cation Dependency, and Comparison with Anti-S-adenosylhomocysteine Antibody." Biochemistry, 39 (2000)
333 Mouse Lipocalin-2 (mLcn2) (Oligo 569)  Protein Mouse Lipocalin-2 (mLcn2) 42 340 nM  Selection Buffer: 50 mM KH2PO4, 150 mM NaCl, 5 mM MgCl2, pH 7.4. 54.76% 5' CCUCCGGCUCAUACCUUUUCGAAGACAAGCUUCGACAGGAGG 3' L. Zhat et al. An RNA aptamer-based microcantilever sensor to detect the inflammatory marker, mouse lipocalin-2. Anal. Chem. 84(2012)
334 Salmonella Typhimurium OmpC Protein (T-2) Protein S. Typhimurium OmpC Protein 42 20 nM  SELEX binding buffer (30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 2 mM dithiothreitol, and 1% BSA) 54.76% Han, S. R. and Lee, S. "In Vitro Selection of RNA Aptamer Specific to Salmonella Typhimurium." Journal of Microbiology and Biotechnology, 23.6(2013)
335 Avian Myeloblastosis Virus (a.1.1) Protein Avian Myeloblastosis Virus (AMV)  43 0.5 nM  Binding Buffer (50 mM Tris-HC1 (pH 7.7), 200 mM potassium acetate, and 10 mM DTT) 55.81% 5' CGUCCCGUGCGCAAAAGUUCUUAGCGCUAGCAGUCCUAGUUGC 3' Chen and Gold. "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994)
336 L-Citrulline (44Cit11) Small Organic L-Citrulline 44 68 nM  Binding Buffer (250 mM NaCl, 50 mM Tris-HCl (pH=8.3), 5 mM MgCl2) 52.27% 5' GACGAGAAGGAGUGCUGGUUAUACUAGCGGUUAGGUCACUCGUC 3' Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706.
337 C-Reactive Protein Monomer (ID# 164) Protein Monomeric C-Reactive Protein (CRP) 44 187.7 nM  Binding Buffer: 20 mM HEPES, 140 mM NaCl, 50 mM KCl, 0.1 mM DTT, and 5% glycerol at pH 6.5  56.82% 5' GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC 3' (A) M S Wang et al. "C-reactive protein (CRP) aptamer binds to monomeric but not pentameric form of CRP." Analytical and Bioanalytical Chemistry, 401(2011): 1309-1318. (B) M S Wang and S M Reed. Direct visualization of electrophoretic mobility shift assays using nanoparticle-aptamer conjugates. Electrophoresis. 33(2012): 348-351.
338 L-Arginine(44Arg11) Small Organic L-Arginine 44 60 nM Binding Buffer (250 mM NaCl, 50 mM Tris-HCl (pH=8.3), 5 mM MgCl2) 56.82% 5' GACGAGAAGGAGCGCUGGUUCUACUAGCAGGUAGGUCACUCGUC 3' Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706
339 Thyroxine (ApT4-A') Small Organic Thyroxine 44 50 µM Loading buffer: 10mM Tris-HCl (pH 7.5), 500 mM NaCl, and 1 mM MgCl2 65.91% 5' GGUGGAGGGGGACGUGCUGCAUCCGCAGUGCGUCUUGGGUUGUG 3' Levesque et al. "In vitro selection and characterization of RNA aptamers binding thyroxine hormone." Biochemical Journal, 403(2007): 129-138.
340 C-Reactive Protein (ID# 454) Protein C-Reactive Protein (CRP) 44 125 nM SPR Binding Buffer: HEPES at pH 6.5 with 0.005% Tween 20 56.82% 5' GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC 3' A Bini, M Mascini, et al. Development of an optical RNA-based aptasensor for C-reactive protein. Anal. Bioanal. Chem. 390(2008): 1077-1088