# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
331 Pepocin (9-41U22) Protein Pepocin 41 18 nM� Binding buffer: 3 mM NaH2PO4, 3 mM MgCl2, 45 mM NaCl, 2.5 mM EDTA, 3 mM Tris-HCl (pH 7.5), 0.15 mM DTT, and 12% glycerol. 43.90% 5' GGGAGUCUGAAGUCGGACUUGUUAUCAAUUCACUUCAGACU 3' Hirao�et al. "RNA Aptamers That Bind to and Inhibit the Ribosome-inactivating Protein, Pepocin."�The Journal of Biological Chemistry,�275(2000)
332 S-adenosyl homocysteine (CTH-5) Small Organic S-adenosyl homocysteine 42 0.1 nM RNA Buffer (300 mM NaCl, 25 mM Tris (pH 7.6), 5 mM MgCl2) HBS Buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3.4 mM EDTA, and 0.005% P-20) Carbonate Buffer (0.05 M NaHCO3 0.125 M NaCl (pH 8.3)) 64.29% 5' GGGCGGAUGAGACGCUUGGCGUGUGCUGUGGAGAGUCAUCCG 3' Gebhardt, K., et al. "RNA Aptamers to S-Adenosylhomocysteine: Kinetic Properties, Divalent Cation Dependency, and Comparison with Anti-S-adenosylhomocysteine Antibody." Biochemistry, 39 (2000)
333 Mouse Lipocalin-2 (mLcn2) (Oligo 569)� Protein Mouse Lipocalin-2 (mLcn2) 42 340 nM� Selection Buffer: 50 mM KH2PO4, 150 mM NaCl, 5 mM MgCl2, pH 7.4. 54.76% 5' CCUCCGGCUCAUACCUUUUCGAAGACAAGCUUCGACAGGAGG 3' L. Zhat et al. An RNA aptamer-based microcantilever sensor to detect the inflammatory marker, mouse lipocalin-2.�Anal. Chem.�84(2012)
334 Salmonella Typhimurium OmpC Protein (T-2) Protein S. Typhimurium OmpC Protein 42 20 nM� SELEX binding buffer (30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 2 mM dithiothreitol, and 1% BSA) 54.76% Han, S. R. and Lee, S. "In Vitro Selection of RNA Aptamer Specific to Salmonella Typhimurium." Journal of Microbiology and Biotechnology, 23.6(2013)
335 Avian Myeloblastosis Virus (a.1.1) Protein Avian Myeloblastosis Virus (AMV)� 43 0.5 nM� Binding Buffer (50 mM Tris-HC1 (pH 7.7), 200 mM potassium acetate, and 10 mM DTT) 55.81% 5' CGUCCCGUGCGCAAAAGUUCUUAGCGCUAGCAGUCCUAGUUGC 3' Chen and Gold. "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994)
336 L-Citrulline (44Cit11) Small Organic L-Citrulline 44 68 nM� Binding Buffer (250 mM NaCl, 50 mM Tris-HCl (pH=8.3), 5 mM MgCl2) 52.27% 5' GACGAGAAGGAGUGCUGGUUAUACUAGCGGUUAGGUCACUCGUC 3' Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706.
337 C-Reactive Protein Monomer�(ID#�164) Protein Monomeric C-Reactive Protein (CRP) 44 187.7 nM� Binding Buffer: 20 mM HEPES, 140 mM NaCl, 50 mM KCl, 0.1 mM DTT, and 5% glycerol at pH 6.5� 56.82% 5' GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC 3' (A) M S Wang et al. "C-reactive protein (CRP) aptamer binds to monomeric but not pentameric form of CRP." Analytical and Bioanalytical Chemistry, 401(2011): 1309-1318. (B) M S Wang and S M Reed. Direct visualization of electrophoretic mobility shift assays using nanoparticle-aptamer conjugates. Electrophoresis. 33(2012): 348-351.
338 L-Arginine(44Arg11) Small Organic L-Arginine 44 60 nM Binding Buffer (250 mM NaCl, 50 mM Tris-HCl (pH=8.3), 5 mM MgCl2) 56.82% 5' GACGAGAAGGAGCGCUGGUUCUACUAGCAGGUAGGUCACUCGUC 3' Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706
339 Thyroxine (ApT4-A') Small Organic Thyroxine 44 50 �M Loading buffer: 10mM Tris-HCl (pH 7.5), 500 mM NaCl, and 1 mM MgCl2 65.91% 5' GGUGGAGGGGGACGUGCUGCAUCCGCAGUGCGUCUUGGGUUGUG 3' Levesque�et al. "In vitro�selection and characterization of RNA aptamers binding thyroxine hormone."�Biochemical Journal,�403(2007): 129-138.
340 C-Reactive Protein�(ID#�454) Protein C-Reactive Protein (CRP) 44 125 nM SPR Binding Buffer: HEPES at pH 6.5 with 0.005% Tween 20 56.82% 5' GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC 3' A Bini, M Mascini, et al. Development of an optical RNA-based aptasensor for C-reactive protein.�Anal. Bioanal. Chem.�390(2008): 1077-1088