# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
561 Dopamine (DNA version of dopa1.30/c.30) Small Organic Dopamine 58 0.7 �M Buffer: 50 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 0.5 M 60.34% 5' GTCTCTGTGTGCGCCAGAGAACACTGGGGCAGATATGGGCCAGCACAGAATGAGGCCC 3' R Walsh and M DeRosa. Retention of function in the DNA homolog of the RNA dopamine aptamer.�Biochem. Biophys. Res. Commun.�388(2009): 732-735.
562 ApoE 06 Protein Apolipoprotein E 59 938 pM PBSMCT (DPBS with 2.5 mM MgCl2, 1 mM CaCl2, 0.05% TWEEN-20) 44.07% 5' GATAAACGCCTTGATTAAAGGCCCAGTTCTTTAGGCCTACACGTGCTGCGACATTAATT 3' Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796�??4801
563 Interferon-Gamma Protein Interferon-gamma (IFN-c) 59 74.5 nM Salmon sperm DNA (0.1 mg/mL) and BSA (1 mg/mL) were added to the binding buffer (PBS) to reduce the background interference 47.46% 5' CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA 3' Cao, B., Hu, Y., Duan, J., Ma, J., Xu, D., & Yang, X. D. (2014). Selection of a novel DNA aptamer for assay of intracellular interferon-gamma. PloS one, 9(5), e98214.
564 B1-4 Protein IFN-Gamma 59 74.5 nM 200 uL (PBS), 0.05 pM Aptamer 47.46% Cao B, Hu Y, Duan J, Ma J, Xu D, et al. (2014) Selection of a Novel DNA Aptamer for Assay of Intracellular Interferon-Gamma. PLoS ONE 9(5): e98214. doi:10.1371/journal.pone.0098214
565 Bacillus thuringiensis spores Cells Bacillus thuringiensis spores 60 N/A nM PBS 60.00% 5' CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC 3' M Ikanovic et al. Fluorescence assay based on aptamer-quantum dot binding to�Bacillus thuringiensis�spores.�J Fluoresc�17(2007): 193-199
566 Lysozyme (Apt 60) Protein Hen egg white lysozyme and recombinant human lysozyme 60 2-3 nM Binding Buffer: 25 mM trizma base, 192 mM glycine, and 5 mM K2HPO4, pH 8.3. 58.33% 5' AGCAGCACAGAGGTCAGATGGCAGGTAAGCAGGCGGCTCACAAAACCATTCGCATGCGGC 3' (A) Tran DT, et al. (2010) Selection and characterization of DNA aptamers for egg white lysozyme.�Molecules�15: 1127 - 1140. (B) Zou M et al. (2012) The homogeneous fluorescence anisotropic sensing of salivary lysozyme using the 6-carboxyfluorescein-labeled DNA aptamer. Biosens. Bioelectron. 32: 148-154
567 Microcystin-LR (AN6) Small Organic Microcystin-LR 60 50 nM Binding Buffer: 50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM MgCl2 55.00% 5' GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGC 3' Ng A, Zourob M, et al. (2012) Selection, characterization and biosensing application of high affinity congener-specific microcystin-targeting aptamers.�Environ. Sci. Technol.�46: 10697-10703.
568 Microcystin (RC6) Small Organic Microcystin 60 28-61 nM Binding Buffer: 50 mM Tris, pH 7.5, 150 mM NaCl, and 2 mM MgCl2 53.33% 5' CACGCAACAACACAACATGCCCAGCGCCTGGAACATATCCTATGAGTTAGTCCGCCCACA 3' Ng A, Zourob M, et al. (2012) Selection, characterization and biosensing application of high affinity congener-specific microcystin-targeting aptamers.�Environ. Sci. Technol.�46: 10697-10703.
569 Fc? receptor III? / CD16? (CLN0020) Protein Fc?rIII? / FcgrIIIa / CD16a 60 22 nM Binding Buffer: DPBS with 0.05% BSA 56.67% 5' GGAGGGAAAAGTTATCAGGCCACTGCGGGGGTCCTATACGTGAGGAAGAAGTGGGCAGGTC 3' Boltz A, Plater B, Hock B, et al. (2011) Bi-specific Aptamers Mediating Tumour Cell Lysis.�J Biol Chem�286: 21896-21905
570 VEGF (3R02 bivalent) Protein Vascular Endothelial Growth Factor (VEGF) 60 30 pM Binding buffer: 10 mM Tris-HCl, 100 mM NaCl, and 5 mM KCl (pH 7.4) 56.67% 5' TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC 3' Nonaka, Y. "Affinity Improvement of a VEGF Aptamer by�in Silico�Maturation for a Sensitive VEGF-Detection System."�Anal. Chem.,�85�(2013): 1132-1137.