To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 601 | Aflatoxin M1 Aptamer (AFAS3) | Small Organic | Aflatoxin M1 | 73 | 35.6 nM | 20 mM Tris-HCL, 100 mM NaCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2 | 60.27% | 5' ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGAAATCGCATTCCCCTGTGGTGTTGGCTCCCGTAT 3' | Malhotra, S., Pandey, A., Rajput, S. and Sharma, R. "Selection of aptamers for Aflatoxin M1 and their characterization." Journal of Molecular Recognition 27 (2014): 493-500. |
| 602 | TGF-ß1 (T18_1_3) | Protein | Transforming Growth Factor-ß1 (TGF-ß1) | 74 | 94 nM | PBS with 1 MgCl2. | 58.11% | 5' CGCTCGGCTTCACGAGATTCGTGTCGTTGTGTCCTGTACCCGCCTTGACCAGTCACTCTAGAGCATCCGGACTG 3' | Kang, Jonghoon, et al. "Combinatorial selection of a single stranded DNA thioaptamer targeting TGF-??1 protein." Bioorganic & Medicinal Chemistry Letters, 18 (2008): 1835-1839. |
| 603 | Protein Kinase C-d | Protein | Protein Kinase C-d | 75 | 122 nM | N/A | 60.00% | 5' GCCAGGGGTTCCACTACGTAGAACACGACGGGAATACTGACTCTCCCCCATGTACCAGGGGGCAGAGAGAAGGGC 3' | Mallikaratchy, P., et al. "Selection of DNA ligands for protein kinase C-d." Chemical Communications, 2006 (2006): 3229-3231. |
| 604 | Vaspin binding aptamer (VBA) | Protein | Vaspin | 75 | 303 nM | Binding Buffer: 100 mM NaCl, 25 mM Tris-HCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2, and 0.02% Tween-20, pH 7.6. | 50.67% | 5' ATACCAGCTTATTCAATTGGGCGGTGGGGGGGGTAGTGGGTGTTATGGCGATCGTGGAGATAGTAAGTGCAATCT 3' | SJ Lee et al. Sensitive detection of adipokines for early diagnosis of type 2 diabetes using enzyme-linked antibody-aptamer sandwich (ELAAS) assays. Sensors Actuat. B-Chem.(2012): 243-248. |
| 605 | G5a3N.4 | Protein | HPV-16E7 protein | 75 | 1.9 µM | 1X PBS | 40.00% | Julia D. Toscano-Garibay, Maria L. Benitez-Hess, and Luis M. Alvarez-Salas. 2011. Isolation and Characterization of an RNA Aptamer for the HPV-16 E7 Oncoprotein. Archives of Medical Research 42 (2011) 88-96 | |
| 613 | cT33 | Protein | 72 | 13.1 ± 2.10 μM | PBS | 56.9% | CACCTAATACGACTCACTATAGGCACAGGGGACGCACGGCGTATGCCAACAGCGCAAGCTTGTTCGAGCCAG | Electrochemiluminescence-Based Lateral Flow Assay for Detection of Cardiac Troponin T Using Aptamers Developed through a Modified SELEX Technique. Vinay BachuMalaya MiliArup DuttaPhurpa Dema ThungonPranab Goswami*. ACS Appl. Opt. Mater. 2024, 2, 8, 1688–1698 | |
| 614 | cT12 | Protein | 72 | 14.42 ± 1.50 μM | PBS | 50% | CACCTAATACGACTCACTATAGACTTCGTATGCCAACAGCGATCCTAGATCGCGCAAGCTTGTTCGAGCCAG | Electrochemiluminescence-Based Lateral Flow Assay for Detection of Cardiac Troponin T Using Aptamers Developed through a Modified SELEX Technique. Vinay BachuMalaya MiliArup DuttaPhurpa Dema ThungonPranab Goswami*. ACS Appl. Opt. Mater. 2024, 2, 8, 1688–1698 | |
| 616 | cT21 | Protein | 72 | 10.7 ± 0.05 μM | PBS | 54.2 | CACCTAATACGACTCACTATAGACTTCGTATGCCAACAGCGCACAGGGGACGCGCAAGCTTGTTCGAGCCAG | Electrochemiluminescence-Based Lateral Flow Assay for Detection of Cardiac Troponin T Using Aptamers Developed through a Modified SELEX Technique. Vinay BachuMalaya MiliArup DuttaPhurpa Dema ThungonPranab Goswami*. ACS Appl. Opt. Mater. 2024, 2, 8, 1688–1698 | |
| 617 | cT22 | Protein | 72 | 49.22 ± 3.33 μM | PBS | 54.2% | CACCTAATACGACTCACTATAGGCACAGGGGACGCACTTCGTATGCCAACAGCGCAAGCTTGTTCGAGCCAG | Electrochemiluminescence-Based Lateral Flow Assay for Detection of Cardiac Troponin T Using Aptamers Developed through a Modified SELEX Technique. Vinay BachuMalaya MiliArup DuttaPhurpa Dema ThungonPranab Goswami*. ACS Appl. Opt. Mater. 2024, 2, 8, 1688–1698 | |
| 618 | Rupiahtoto | Skks | Sjsj | Sjsk | Sjsj | Sjje | Ksk | Jsjs |