# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
361 S. Enterica Serovar Typhi IVP Pili Protein (S-PS8.4) (ID# 127) Protein S. Enterica Serovar Typhi IVP Pili Protein 71 7.2 nM Binding Buffer (25 mM Tris-HCl, 50 mM KCl, 200 mM NaCl, 0.2 mM EDTA, 5% [vol/vol] glycerol, 0.5 mM DTT) 59.15% 5' GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC 3' Pan, Q., et al. "Aptamers That Preferentially Bind Type IVB Pili and Inhibit Human Monocytic-Cell Invasion by Salmonella enterica Serovar Typhi." Antimicrobial Agents and Chemotherapy, 49(2005): 4052-4060.
362 FMN-inhibited molecular switch (ID# 400) Small Organic flavin mononucleotide (FMN) 71 na nM Reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr 57.75% 5' GGGCGACCCUGAUGAGAUGAGGAUAUGCUUCGGCAGAAGGCUCUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.
363 FMN-induced molecular switch (ID# 395) Small Organic flavin mononucleotide (FMN) 72 na nM  Reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr 58.33% 5' GGGCGACCCCUGAUGAGCCUUAGGAUAUGCUUCGGCAGAAGGACGUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.
364 FMN-induced molecular switch (ID# 396) Small Organic flavin mononucleotide (FMN) 72 na nM Reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr 58.33% 5' GGGCGACCCUGAUGAGCCUUAGGAUAUGCUUCGGCAGAAGGACGUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.
365 Hepatitis C Virus Non-Structural Protein 3 (G9-1) (ID# 124) Protein Hepatitis C Virus Non-Structural Protein 3 73 11.6 nM Binding Buffer (50 mM Tris/HCl (pH 7.8), 30 mM NaCl, 5 mM CaCl2 and 10 mM dithiothreitol) Elution Buffer (0.4 m sodium acetate, 5 mm EDTA and 7 m urea (pH 5.5)) 50.68% 5' GGGAGAAUUCCGACCAGAAGCUUCGGGAUUUGAGGGUAGAAUGGGACUACCUUUCCUCUCUCCUUCCUCUUCU 3' Fukuda, et al. "Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease." European Journal of Biochemistry, 267(2000): 3685-3694.
366 Beta 2-Integrin (D20) (ID# 139) Protein Beta 2-Integrin 73 500 nM Binding Buffer (4.3 mM K2HPO4, 1.4 mM NaH2PO4, 150 mM NaCl, 1.0 mM MgCl2, 0.1 uM CaCl2) 64.38% 5' GGGCGCUAAGUCCUCGCUCAUGCGCGUCCCAUGGGGUAUAGAGGGGUCGAAGUGGACGCGCGACUCGGAUCCU 3' Blind, M., et al. "Cytoplasmic RNA modulators of an inside-out signaltransduction cascade." Proceedings of National Academy of Sciences of the United States of America, 96(1999):3606ƒ??3610.
367 Human Influenza A virus H3N2 (P30-10-16) (ID# 121) Cells Human Influenza A virus H3N2 74 0.188 nM Binding Buffer (20 nM HEPES/KOH (pH 7·4), 105 mM NaCl) PIPES buffer (5 mM PIPES/NaOH, 145 mM NaCl (pH 7·5)) Acidic buffer (145 mM NaCl, 20 mM sodium citrate, 1 U RNase inhibitor ”l-1 (pH 5·0)) 54.05% 5' GGGAGAAUUCCGACCAGAAGGGUUAGCAGUCGGCAUGCGGUACAGACAGACCUUUCCUCUCUCCUUCCUCUUCU 3' Gopinath, S., et al. "An RNA aptamer that distinguishes between closely related human influenza viruses and inhibits haemagglutinin-mediated membrane fusion." Journal of General Virology, 87(2005): 479-487.
368 Unphosphorylated ERK2 (ID# 264) Protein Unphosphorylated ERK2 75 2 nM  4-37 °C, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 0.05 ?g/?l tRNA 57.33% 5' GGCGUGACCUGAUGAGUCACGCUAAGGAGGAUUUCCGAAAGCGGCUACGGUCCGCCAGUGUUACGAAACGUUCCC 3' Vaish et al. "Monitoring post-translational modifications of proteins with allosteric ribozymes." Nature Biotechnology, 20(2002): 810-815.
369 theophylline-inhibited molecular switch (ID# 398) Small Organic theophylline 75 na nM  Reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr 60.00% 5' GGGCGACCCUGAUGAGAUGAUACCAGCCGAAAGGCCCUUGGCAGCUCUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589
370 theophylline-induced molecular switch (ID# 397) Small Organic theophylline 76 na nM  Reaction buffer [50 mM Tris.HCl (pH 7.5) and 20 mM MgCl2] for 20 hr 60.53% 5' GGGCGACCCUGAUGAGCCUUAUACCAGCCGAAAGGCCCUUGGCAGACGUCGAAACGGUGAAAGCCGUAGGUUGCCC 3' Garrett A. Soukup and Ronald R. Breaker. "Engineering precision RNA molecular switches" Proc. Natl. Acad. Sci. 96(1999):3584-3589.