# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
591 C-Reactive Protein (CRP) Protein C-Reactive Protein (CRP) 80 3.51 nM DNA and CRP-conjugated magnetic beads mixed and incubated utilizing a membrane-type micropump/micromixer (for about 5min). Dissociation constant determined using a SPR technique. SPR Buffer: 10 mM Tris buffer with 50 mM NaCl and 2 mM CaCl2. 51.39% 5' GGCAGGAAGACAAACACGATGGGGGGGTATGATTTGATGTGGTTGTTGCATGATCGTGGTCTGTGGTGCTGT 3' C-J Huang et al. "Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX)." Biosens. Bioelectron. 25(2010):1761-1766.
592 Heparanase (3M NaSCN) Protein Heparanase (HPSE1) 72 13 nM Salt Solution: 100 mM NaCl, 20 mM KCl, 5 mM MgCl2 43.06% 5' GGGAGACAAGAATAAACGCTCAATTTAACGTATTTATTCAAGCTCGTATTCGACAGGAGGCTCACAACAGGC 3' Simmons, SC, et al. Development of novel single-stranded nucleic acid aptamers against the pro-angiogenic and metastatic enzyme heparanase (HPSE1). PLoS One (2012) 7:e37938.
593 Heparanase (1.5M NaCl) Protein Heparanase (HPSE1) 72 12 nM  Salt Solution: 100 mM NaCl, 20 mM KCl, 5 mM MgCl2 45.83% 5' GGGAGACAAGAATAAACGCTCAAATGGACTTTTGAATGTGGCAACAAATTCGACAGGAGGCTCACAACAGGC 3' Simmons, SC, et al. Development of novel single-stranded nucleic acid aptamers against the pro-angiogenic and metastatic enzyme heparanase (HPSE1). PLoS One (2012) 7:e37938.
594 Acetylcholine (ACh 6R) Small Organic Acetylcholine 72 N/A nM Binding Buffer: 0.5 M NaCl, 10 mM Tris HCl, and 1 mM MgCl2 .  54.17% 5' ATCCGTCACACCTGCTCTCAGGGGATCACATTCTTGACGGTGTGATACAGTGCCTGGTGTTGGCTCCCGTAT 3' J.G. Bruno et al. Development of DNA aptamers for cytochemical detection of acetylcholine. In Vitro Cell. Dev. Biol.-Anim. 44(2008):63-72.
595 MUC1 Tumor Marker (MUC1-5TR-1)  Protein MUC1 recombinant protein with five repeats of the variable tandem repeat region 72 47.3 nM Running Buffer for SPR/Binding Buffer: 100 mM NaCl, 5 mM MgCl2, pH 7.4. 45.83% 5' GGGAGACAAGAATAAACGCTCAAGAAGTGAAAATGACAGAACACAACATTCGACAGGAGGCTCACAACAGGC 3' C Ferreira et al. DNA aptamers against the MUC1 tumour marker: design of aptamer-antibody sandwich ELISA for the early diagnosis of epithelial tumors. Anal. Bioanal. Chem. 390(2008):1039-1050.
596 Bacillus anthracis spores (BAS-6F) Other Bacillus anthracis spores 72 N/A nM Binding buffer: 0.5 M NaCl, 10 mM Tris-HCl, 1 mM MgCl2 (pH 7.5-7.6) 54.17% 5' ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT 3' Bruno, J. G. and Carrillo, M. P. "Development of aptamer beacons for rapid presumptive detection of Bacillus spores." J Fluoresc, 22 (2012): 915-924.
597 Hemoglobin Aptamer Protein Hemoglobin 72 7.6 nM  Aptamer binding took place in human blood sample produced by centrifuging 100 µL of whole human blood, collecting the pellet of red blood cells, resuspending the pellet in 50 µL of deionized water, and straining the resulting suspension. 55.56% 5' GGCAGGAAGACAAACACCAGGTGAGGGAGACGACGCGAGTGTTAGATGGTAGCTGTTGGTCTGTGGTGCTGT 3' J Li et al. On chip, aptamer-based sandwich assay for detection of glycated hemoglobins via magnetic beads. Biosensors and Bioelectronics 79 (2016): 887-893
598 Glycated Hemoglobin Aptamer Protein Glycated Hemoglobin 72 7.3 nM Aptamer binding took place in human blood sample produced by centrifuging 100 µL of whole human blood, collecting the pellet of red blood cells, resuspending the pellet in 50 µL of deionized water, and straining the resulting suspension. 66.67% 5' TGGCAGGAAGACAAACACATCGTCGCGGCCTTAGGAGGGGCGGACGGGGGGGGGCGTGGTCTGTGGTGCTGT 3' J Li et al. On chip, aptamer-based sandwich assay for detection of glycated hemoglobins via magnetic beads. Biosensors and Bioelectronics 79 (2016): 887-893
599 M13a Peptide PSL 72 4.59 µM 200 µL of binding buffer (137 mM NaCl, 0.5 mM MgCl2, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, pH 7.4) 52.78% Hongcheng Mei, Tao Bing, Xiaojuan Yang, Cui Qi, Tianjun Chang, Xiangjun Liu, Zehui Cao, and Dihua Shangguan. 2012. Functional-Group Specific Aptamers Indirectly Recognizing Compounds with Alkyl Amino Group. Anal. Chem. 2012, 84, 7323-7329
600 MUC1-5TR-1 Cells human breast adenocarcinoma (MCF7) 72 47.3 nM 0.5M NaCl, 10mM Tris-HCl, 1mM MgCl2, in Nuclease Free Water, pH 7.5-7.6 45.83% 5' GGGAGACAAGAATAAACGCTCAAGAAGTGAAAATGACAGAACACAACATTCGACAGGAGGCTCACAACAGGC 3' C Ferreira et al. DNA aptamers against the MUC1 tumour marker: design of aptamer-antibody sandwich ELISA for the early diagnosis of epithelial tumors. Anal. Bioanal. Chem. 390(2008):1039-1050.