To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 571 | Okadaic Acid Aptamer (OA-34) | Small Organic | Okadaic acid | 60 | 77 nM | 50 mM Tris, pH 7.5, 150 mM NaCl, 2 mM MgCl2 | 58.33% | Eissa, S., Ng, A., Siaj, M., Tavares, A., and Zourob, M. "Selection and Identification of DNA Aptamers against Okadaic Acid for Biosensing Application." Analytical Chemistry 85.24 (2013): 11794-801. | |
| 572 | Thrombin 03 | Protein | Thrombin | 60 | 7.03 pM | PBSMCT (DPBS with 2.5 mM MgCl2, 1 mM CaCl2, 0.05% TWEEN-20) | 55.00% | 5' CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG 3' | Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796??4801 |
| 573 | PAI-1 01 | Protein | Plasminogen Activator Inhibitor-1 | 60 | 339 pM | PBSMCT (DPBS with 2.5 mM MgCl2, 1 mM CaCl2, 0.05% TWEEN-20) | 51.67% | 5' CATTGAGATAGCTAGTTGTAGCTGCGTCATAGGCTGGGTTGGGTCTAGTGGTTGGGTGTG 3' | Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796??4801 |
| 574 | 4-1BB 07 | Protein | 4-1BB Ligand | 60 | 2.32 nM | PBSMCT (DPBS with 2.5 mM MgCl2, 1 mM CaCl2, 0.05% TWEEN-20) | 51.67% | 5' GTCAGATTCCACTATAGTAGGTTGGGTAGGGTGGTCGCAGTGGATGATATGTCGTAGGGG 3' | Wang, J., Gong, Q., Maheshwari, N., Eisenstein, M., Luz Arcila, M., Kosik, K., & Soh, T. Particle Display: A Quantitative Screening Method for Generating High-Affinity Aptamers. Angew. Chem. Int. Ed. 2014, 53, 4796??4801 |
| 575 | Escherichia coli (E. coli) fimbriae protein K88 (clone 37) | Protein | K88 | 60 | 25 nM | 20 mmol/L HEPES, 1 mmol/L MgCl2; 1 mmol/L CaCl2; and 120 mmol/L KCl | 56.67% | Li, H. et al. Aptamer selection for the detection of Escherichia coli K88. 2011. Canadian Journal of Microbiology 57.6: 453-9. | |
| 576 | Botulinum neurotoxin type A (BoNT A) Aptamer | Protein | BoNT A Light Chain (BoNT/A-rLc) | 60 | 34 nM | 1X Binding Buffer: 20 mM Hepes, 150 mM NaCl, 2 mM KCl, 2 mM MgCl2, 2mM CaCl2 (pH 7.4) | 46.67% | 5' CTTGAGTGTCATGGACGTTCCGGTCTTGGGCGGGATATTTGTTTGTTTTCTGCCTATGTT 3' | (1) Bogomolova, A., Aldissi, M. ??Real-time and label-free analyte detection in a flow-through mode using immobilized fluorescent aptamer/quantum dots molecular switches.? Biosensors and Bioelecgtronics, 66 (2015): 290-296. (2) Lou, X., et al. ??Micromagnetic selection of aptamers in microfluidic channels.? PNAS, 106, 9 (2009): 2989-2994. |
| 577 | Pro-Gastrin Releasing Peptide | Protein | Pro-gastrin releasing peptide (proGRP) | 61 | 1.2 µM | SELEX buffer used in SPR binding assay: 137 mM NaCl, 8.1 mM Na2HPO4, 2.68 mM KCl, 1.47 mM KH2PO4, 0.9 mM CaCl2, 5.3 mM MgCl2, and 4.5 g/L glucose (pH 7.4) | 32.79% | 5' ATACCAGCTTATTCAATTTGCACCACTTATTGTTACTAATCTGAGATAGTAAGTGCAATCT 3' | M Mie et al. (2012) Selection of DNA aptamers with affinity for Pro-gastrin-Releasing Peptide (proGRP), a tumor marker for small cell lung cancer. Appl. Biochem. Biotechnol. Published Online ahead of Print: DOI 10.1007/s12010-012-9956-5 |
| 578 | NaA43 | Other | Sodium Ion | 61 | 39.1 mM | Dulbeccos modification of Eagles medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin, | 63.93% | 5' GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTACATAGAG 3' | Torabi, S., Wu, P., McGhee, C., Chen, L., Hwang, K., Zheng, N., Cheng, J., & Lu, Y. (2015) In Vitro Selection of a Sodium-Specific DNAzyme and its Application in Intracellular Sensing. PNAS 112, (19):5903-5908 |
| 579 | Aptamer 1.12 | Protein | Ochratoxin A (OTA) | 61 | 0.36 µM | Selection Buffer (SB): 10mM HEPES, pH 7.0, 120mM NaCl, 5mM KCl, 5mM MgCl2 | 59.02% | 5' TGGTGGCTGTAGGTCAGCATCTGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAACG 3' | Jorge A. Cruz-Aguado, Gregory Penner, "Determination of Ochratoxin A with a DNA Aptamer", J. Agric. Food Chem. (2008), 56, 10456-10461. |
| 580 | Human Hepatocellular carcinoma (TLS11a) | Cells | Human Hepatocellular carcinoma cell line (LH86) | 63 | 7.16 nM | Binding buffer (PBS containing 5 mM MgCl2, 4.5 mg/mL glucose, 0.1 mg/mL yeast tRNA, 1 mg/mL BSA) | 50.79% | 5' ACAGCATCCCCATGTGAACAATCGCATTGTGATTGTTACGGTTTCCGCCTCATGGACGTGCTG 3' | Meng, L. (2012). Targeted delivery of chemotherapy agents using liver cancer-specific aptamer. PloS One, 7(4), doi: 10.1371 |