# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
551 Isocarbophos (SS4-54) Small Organic Isocarbophos 54 0.9 �M Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 46.30% 5' AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAT 3' Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6
552 Omethoate (SS4-54) Small Organic Omethoate 54 2 �M Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 46.30% 5' AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG 3' Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6
553 Uranium DNAzyme Other Uranium 54 n/a nM� 0.4 M NaCl and 20 mM MES buffer solution (pH 5.5) at 20?C for 15 min. To quench: 5 uL of 0.5 M Tris base solution added then sample was vortexed to shift the pH from 5.5 to 8.0. 51.85% Sai Jin Xiao, Jun Zuo, Zhi Qiang Zhu, Yong Zhong Ouyang, Xing Lei Zhang, Huan Wen Chen, & Li Zhang (2015) Highly Sensitive DNAzyme Sensor for Selective Detection of Trace Uranium in Ore and Natural Water Samples. Sensors and Actuators B 210 (2015) 656-660
554 Phorate (SS2-55) Small Organic Phorate 55 1.11 �M Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 49.09% 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6
555 Profenofos (SS2-55) Small Organic Profenofos 55 1 �M Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 49.09% 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6
556 Isocarbophos (SS2-55) Small Organic Isocarbophos 55 0.83 �M Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 49.09% 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6
557 Omethoate (SS2-55) Small Organic Omethoate 55 2.5 �M� Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 49.09% 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6
558 Antibac1� Other peptidoglycan 55 268.50 nM Selection buffer (PBS containing 1.4 mM MgCl2 and 0.05% BSA); Room temperature (45 mins) 72.73% 5' TCGCGGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCATCGTCCTCCC 3' A Graziani et al. High efficiency binding aptamers for a wide range of sepsis 1 bacterial agents. JMB Papers in Press. 2017: JMB16-11004.
559 Antibac 2 Other peptidoglycan 55 195.90 nM Selection buffer (PBS containing 1.4 mM MgCl2 and 0.05% BSA); Room temperature (45 mins) 69.09% 5' TCGCGCGAGTCGTCTGGGGGACTAGAGGACTTGTGCGGCCCCGCATCGTCCTCCC 3' A Graziani et al. High efficiency binding aptamers for a wide range of sepsis 1 bacterial agents. JMB Papers in Press. 2017: JMB16-11004.
560 Pb(II) Small Organic Pb(II) 56 4 nM Buffer A (50 mM HEPES, 500 mM NaCl, 20 uM EDTA (pH 7.0) 50.00% 5' ACTCACTATGGAAGAGATGGCGACATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT 3' Lu et al. "New highly sensitive and selective catalytic DNA biosensors for metal ions." Biosensors and Bioelectronics, 18(2003): 529-540.