To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
551 | Isocarbophos (SS4-54) | Small Organic | Isocarbophos | 54 | 0.9 �M | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 46.30% | 5' AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAT 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
552 | Omethoate (SS4-54) | Small Organic | Omethoate | 54 | 2 �M | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 46.30% | 5' AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
553 | Uranium DNAzyme | Other | Uranium | 54 | n/a nM� | 0.4 M NaCl and 20 mM MES buffer solution (pH 5.5) at 20?C for 15 min. To quench: 5 uL of 0.5 M Tris base solution added then sample was vortexed to shift the pH from 5.5 to 8.0. | 51.85% | Sai Jin Xiao, Jun Zuo, Zhi Qiang Zhu, Yong Zhong Ouyang, Xing Lei Zhang, Huan Wen Chen, & Li Zhang (2015) Highly Sensitive DNAzyme Sensor for Selective Detection of Trace Uranium in Ore and Natural Water Samples. Sensors and Actuators B 210 (2015) 656-660 | |
554 | Phorate (SS2-55) | Small Organic | Phorate | 55 | 1.11 �M | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 49.09% | 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
555 | Profenofos (SS2-55) | Small Organic | Profenofos | 55 | 1 �M | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 49.09% | 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
556 | Isocarbophos (SS2-55) | Small Organic | Isocarbophos | 55 | 0.83 �M | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 49.09% | 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
557 | Omethoate (SS2-55) | Small Organic | Omethoate | 55 | 2.5 �M� | Selection buffer used in binding affinity assays: 300mM NaCl, 50 mM KCl, 10 mM MgCl2, 50 mM Tris/HCl, and pH 8.3 | 49.09% | 5' AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC 3' | Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides.�Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6 |
558 | Antibac1� | Other | peptidoglycan | 55 | 268.50 nM | Selection buffer (PBS containing 1.4 mM MgCl2 and 0.05% BSA); Room temperature (45 mins) | 72.73% | 5' TCGCGGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCATCGTCCTCCC 3' | A Graziani et al. High efficiency binding aptamers for a wide range of sepsis 1 bacterial agents. JMB Papers in Press. 2017: JMB16-11004. |
559 | Antibac 2 | Other | peptidoglycan | 55 | 195.90 nM | Selection buffer (PBS containing 1.4 mM MgCl2 and 0.05% BSA); Room temperature (45 mins) | 69.09% | 5' TCGCGCGAGTCGTCTGGGGGACTAGAGGACTTGTGCGGCCCCGCATCGTCCTCCC 3' | A Graziani et al. High efficiency binding aptamers for a wide range of sepsis 1 bacterial agents. JMB Papers in Press. 2017: JMB16-11004. |
560 | Pb(II) | Small Organic | Pb(II) | 56 | 4 nM | Buffer A (50 mM HEPES, 500 mM NaCl, 20 uM EDTA (pH 7.0) | 50.00% | 5' ACTCACTATGGAAGAGATGGCGACATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT 3' | Lu et al. "New highly sensitive and selective catalytic DNA biosensors for metal ions." Biosensors and Bioelectronics, 18(2003): 529-540. |